Starting /dee2/code/volunteer_pipeline.sh SRR5423475 current disk space = 3052006100992 free memory = 1576911276 SRR5423475 SRAfilesize 822b9fea6f71a06ffb2301457028a98d SRR5423475.sra SRR5423475.sra file validated SRR5423475 is single end SRR5423475 is conventional basespace SRR5423475 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423475_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.39 34.0 31.0 34.0 30.0 34.0 2 32.395 34.0 31.0 34.0 30.0 34.0 3 32.58975 34.0 31.0 34.0 31.0 34.0 4 35.99225 37.0 35.0 37.0 35.0 37.0 5 35.9935 37.0 35.0 37.0 35.0 37.0 6 36.04775 37.0 35.0 37.0 35.0 37.0 7 35.96975 37.0 35.0 37.0 35.0 37.0 8 35.9435 37.0 35.0 37.0 35.0 37.0 9 37.7205 39.0 38.0 39.0 35.0 39.0 10 37.637 39.0 38.0 39.0 35.0 39.0 11 37.6755 39.0 38.0 39.0 35.0 39.0 12 37.63375 39.0 37.0 39.0 35.0 39.0 13 37.6585 39.0 37.0 39.0 35.0 39.0 14 39.01025 40.0 38.0 41.0 36.0 41.0 15 38.83975 40.0 38.0 41.0 35.0 41.0 16 38.935 40.0 38.0 41.0 36.0 41.0 17 39.0335 40.0 38.0 41.0 36.0 41.0 18 39.02075 40.0 38.0 41.0 36.0 41.0 19 38.9535 40.0 39.0 41.0 35.0 41.0 20 38.89175 40.0 38.0 41.0 35.0 41.0 21 39.043 40.0 39.0 41.0 36.0 41.0 22 38.9245 40.0 39.0 41.0 35.0 41.0 23 38.8115 40.0 38.0 41.0 34.0 41.0 24 38.93925 40.0 39.0 41.0 35.0 41.0 25 38.91825 40.0 38.0 41.0 35.0 41.0 26 38.86725 40.0 38.0 41.0 35.0 41.0 27 38.82625 40.0 38.0 41.0 35.0 41.0 28 38.92075 40.0 39.0 41.0 35.0 41.0 29 38.795 40.0 38.0 41.0 35.0 41.0 30 38.696 40.0 38.0 41.0 34.0 41.0 31 38.61425 40.0 38.0 41.0 34.0 41.0 32 38.58825 40.0 38.0 41.0 34.0 41.0 33 38.5415 40.0 38.0 41.0 34.0 41.0 34 38.511 40.0 38.0 41.0 34.0 41.0 35 38.3615 40.0 38.0 41.0 34.0 41.0 36 38.37025 40.0 38.0 41.0 34.0 41.0 37 38.38575 40.0 38.0 41.0 34.0 41.0 38 38.31975 40.0 38.0 41.0 33.0 41.0 39 38.08525 40.0 38.0 41.0 33.0 41.0 40 38.2005 40.0 38.0 41.0 33.0 41.0 41 38.1725 40.0 38.0 41.0 33.0 41.0 42 38.03 40.0 38.0 41.0 33.0 41.0 43 38.0865 40.0 38.0 41.0 33.0 41.0 44 38.04625 40.0 38.0 41.0 33.0 41.0 45 37.89025 40.0 37.0 41.0 33.0 41.0 46 37.76075 40.0 37.0 41.0 33.0 41.0 47 37.7365 40.0 37.0 41.0 32.0 41.0 48 37.73225 40.0 37.0 41.0 33.0 41.0 49 37.84075 40.0 37.0 41.0 33.0 41.0 50 37.71625 40.0 37.0 41.0 32.0 41.0 51 37.5985 40.0 37.0 41.0 32.0 41.0 52 36.766 39.0 36.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2107 1 0.0 2107 2 0.0 2107 3 0.0 2107 4 0.0 2107 5 0.0 2107 6 0.0 2107 7 0.0 2107 8 0.0 2107 9 0.0 2107 10 0.0 2107 11 0.0 2107 12 0.0 2107 13 0.0 2107 14 0.0 2107 15 0.0 2107 16 0.0 2107 17 0.0 2107 18 0.0 2107 19 0.0 2107 20 0.0 2107 21 0.0 2107 22 0.0 2107 23 0.0 2107 24 0.0 2107 25 0.0 2107 26 0.0 2107 27 0.0 2107 28 0.0 2107 29 0.0 2107 30 0.0 2107 31 0.0 2107 32 0.0 2107 33 0.0 2107 34 0.0 2107 35 0.0 2107 36 0.0 2107 37 0.0 2107 38 0.0 2107 39 0.0 2107 40 0.0 2107 41 0.0 2107 42 0.0 2107 43 0.0 2107 44 0.0 2107 45 0.0 2107 46 0.0 2107 47 0.0 2107 48 0.0 2107 49 0.0 2107 50 0.0 2107 51 0.0 2107 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 2.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.0 23 1.0 24 11.0 25 11.0 26 12.0 27 13.0 28 27.0 29 27.0 30 59.0 31 56.0 32 73.0 33 110.0 34 133.0 35 169.0 36 246.0 37 348.0 38 735.0 39 1959.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.24524524524524 12.462462462462462 6.031031031031031 36.26126126126126 2 21.775 16.625 36.0 25.6 3 18.85 20.775 27.325 33.050000000000004 4 23.0 30.675 22.35 23.974999999999998 5 21.55 33.625 23.849999999999998 20.974999999999998 6 19.625 32.525 23.95 23.9 7 16.225 21.625 41.675000000000004 20.474999999999998 8 16.875 21.075 31.075000000000003 30.975 9 18.4 19.950000000000003 32.675 28.975 10 20.474999999999998 35.675000000000004 22.2 21.65 11 25.25 24.224999999999998 20.599999999999998 29.925 12 22.5 23.150000000000002 25.474999999999998 28.875 13 21.224999999999998 25.474999999999998 27.525 25.775 14 21.0 24.9 28.675 25.424999999999997 15 20.849999999999998 24.0 27.650000000000002 27.500000000000004 16 22.7 26.375 25.074999999999996 25.85 17 20.8 25.3 27.275 26.625 18 22.225 24.75 27.400000000000002 25.624999999999996 19 22.175 26.424999999999997 25.5 25.900000000000002 20 21.675 25.825 26.6 25.900000000000002 21 20.599999999999998 25.6 26.275 27.525 22 23.05 26.825 24.825 25.3 23 22.05 25.624999999999996 26.450000000000003 25.874999999999996 24 21.15 25.074999999999996 26.700000000000003 27.075 25 20.45 27.875 26.924999999999997 24.75 26 21.4 25.5 26.575 26.525 27 22.3 24.474999999999998 25.05 28.175 28 21.75 26.325 25.15 26.775 29 21.325 26.075 27.325 25.275 30 21.9 24.725 26.75 26.625 31 21.5 25.974999999999998 25.724999999999998 26.8 32 22.375 24.975 26.55 26.1 33 22.275 23.150000000000002 27.05 27.525 34 22.025 26.424999999999997 25.674999999999997 25.874999999999996 35 20.925 24.45 28.299999999999997 26.325 36 22.375 24.125 26.075 27.425 37 22.5 26.075 25.95 25.474999999999998 38 22.225 24.675 27.075 26.025 39 20.3 25.324999999999996 25.45 28.925 40 21.175 26.424999999999997 25.525 26.875 41 22.75 25.3 26.025 25.924999999999997 42 22.425 24.85 27.05 25.674999999999997 43 23.474999999999998 24.425 25.224999999999998 26.875 44 22.925 24.625 27.925 24.525 45 23.1807951987997 24.031007751937985 26.281570392598148 26.506626656664167 46 22.380595148787197 27.031757939484873 24.15603900975244 26.431607901975497 47 22.305576394098527 24.58114528632158 25.95648912228057 27.156789197299325 48 22.73068267066767 23.330832708177045 26.431607901975497 27.506876719179797 49 22.58064516129032 26.556639159789945 25.906476619154787 24.956239059764943 50 22.280570142535634 24.656164041010253 26.30657664416104 26.756689172293076 51 21.45536384096024 23.355838959739934 27.131782945736433 28.057014253563388 52 22.45 24.675 26.575 26.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 2.0 18 2.5 19 3.0 20 3.0 21 3.0 22 3.5 23 4.0 24 5.5 25 7.0 26 12.0 27 17.0 28 18.0 29 19.0 30 34.0 31 49.0 32 50.5 33 52.0 34 66.5 35 81.0 36 103.5 37 126.0 38 137.0 39 174.5 40 201.0 41 229.5 42 258.0 43 282.5 44 307.0 45 345.0 46 383.0 47 375.5 48 368.0 49 386.5 50 405.0 51 394.5 52 384.0 53 367.5 54 351.0 55 297.0 56 243.0 57 204.0 58 165.0 59 161.5 60 158.0 61 127.5 62 97.0 63 73.0 64 46.0 65 43.0 66 35.5 67 28.0 68 24.5 69 21.0 70 15.5 71 10.0 72 9.5 73 9.0 74 5.5 75 2.0 76 2.5 77 3.0 78 2.0 79 1.0 80 0.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.025 46 0.025 47 0.025 48 0.025 49 0.025 50 0.025 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88692132557551 97.725 2 1.037186946622818 2.0500000000000003 3 0.07589172780166961 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.025 0.0 0.0 0.0 3 0.0 0.025 0.0 0.0 0.0 4 0.0 0.025 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10 0.0 0.025 0.0 0.0 0.0 11 0.0 0.025 0.0 0.0 0.0 12 0.0 0.025 0.0 0.0 0.0 13 0.0 0.025 0.0 0.0 0.0 14 0.0 0.025 0.0 0.0 0.0 15 0.0 0.025 0.0 0.0 0.0 16 0.0 0.025 0.0 0.0 0.0 17 0.0 0.025 0.0 0.0 0.0 18 0.0 0.025 0.0 0.0 0.0 19 0.0 0.025 0.0 0.0 0.0 20 0.0 0.025 0.0 0.0 0.0 21 0.0 0.025 0.0 0.0 0.0 22 0.0 0.025 0.0 0.0 0.0 23 0.0 0.025 0.0 0.0 0.0 24 0.0 0.025 0.0 0.0 0.0 25 0.0 0.025 0.0 0.0 0.0 26 0.0 0.025 0.0 0.0 0.0 27 0.0 0.025 0.0 0.0 0.0 28 0.0 0.025 0.0 0.0 0.0 29 0.0 0.025 0.0 0.0 0.0 30 0.0 0.025 0.0 0.0 0.0 31 0.0 0.025 0.0 0.0 0.0 32 0.0 0.025 0.0 0.0 0.0 33 0.0 0.025 0.0 0.0 0.0 34 0.0 0.025 0.0 0.0 0.0 35 0.0 0.025 0.0 0.0 0.0 36 0.0 0.025 0.0 0.0 0.0 37 0.0 0.025 0.0 0.0 0.0 38 0.0 0.025 0.0 0.0 0.0 39 0.0 0.025 0.0 0.0 0.0 40 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra Read 200000 spots for SRR5423475.sra Written 200000 spots for SRR5423475.sra SRR ids: ['SRR5423475.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bqm4l_do SRR5423475.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423475 file size 703976 SRR5423475 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423475 SRR5423475_1.fastq Input file: SRR5423475_1.fastq trimmed: SRR5423475-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 16:19:33 2025 >> started Wed Feb 12 16:19:35 2025 >> done (2.018s) 4000000 reads processed; of these: 217 ( 0.01%) short reads filtered out after trimming by size control 93 ( 0.00%) empty reads filtered out after trimming by size control 3999690 (99.99%) reads available; of these: 57125 ( 1.43%) trimmed reads available after processing 3942565 (98.57%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 7 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 1 0.00% 26 5 0.00% 27 8 0.00% 28 6 0.00% 29 9 0.00% 30 8 0.00% 31 10 0.00% 32 17 0.00% 33 17 0.00% 34 19 0.00% 35 19 0.00% 36 20 0.00% 37 26 0.00% 38 41 0.00% 39 48 0.00% 40 55 0.00% 41 75 0.00% 42 76 0.00% 43 123 0.00% 44 211 0.01% 45 268 0.01% 46 410 0.01% 47 600 0.02% 48 1023 0.03% 49 2234 0.06% 50 6446 0.16% 51 45329 1.13% 52 3942565 98.57% 3999690 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=31 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=153.90 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=19.3 sequence=CTTCTTCTTCTC Started job on | Feb 12 16:19:49 Started mapping on | Feb 12 16:19:49 Finished on | Feb 12 16:19:54 Mapping speed, Million of reads per hour | 2879.78 Number of input reads | 3999690 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3592250 Uniquely mapped reads % | 89.81% Average mapped length | 51.85 Number of splices: Total | 452177 Number of splices: Annotated (sjdb) | 446999 Number of splices: GT/AG | 444820 Number of splices: GC/AG | 6539 Number of splices: AT/AC | 316 Number of splices: Non-canonical | 502 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313804 % of reads mapped to multiple loci | 7.85% Number of reads mapped to too many loci | 79849 % of reads mapped to too many loci | 2.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.34% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 93636 93636 93636 N_multimapping 313804 313804 313804 N_noFeature 109782 3558588 122700 N_ambiguous 35933 53 15159 UnstrandedReadsAssigned:3446535 PositiveStrandReadsAssigned:33609 NegativeStrandReadsAssigned:3454391 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423475 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423475-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,690 reads, 3,681,926 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR5423475.ke.tsv 34699 SRR5423475.se.tsv 87100 total ==> SRR5423475.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 49 7.79658 Potri.005G024800.1.v4.1 1035 936 5.00646 1.6332 Potri.004G059700.1.v4.1 961 862 6 2.12533 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 48.6079 5.21868 Potri.016G087400.1.v4.1 270 171 165 294.626 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 5 0.912006 Potri.012G127500.1.v4.1 977 878 199 69.2057 ==> SRR5423475.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 85 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423475 completed mapping pipeline successfully