Starting /dee2/code/volunteer_pipeline.sh SRR5423476 current disk space = 3051959595008 free memory = 1579763004 SRR5423476 SRAfilesize 4b0c47a3520b7b19aa54a7cb30d916d7 SRR5423476.sra SRR5423476.sra file validated SRR5423476 is single end SRR5423476 is conventional basespace SRR5423476 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423476_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6635 34.0 31.0 34.0 31.0 34.0 2 32.6945 34.0 31.0 34.0 31.0 34.0 3 32.70275 34.0 31.0 34.0 31.0 34.0 4 36.197 37.0 37.0 37.0 35.0 37.0 5 36.2105 37.0 37.0 37.0 35.0 37.0 6 36.16525 37.0 37.0 37.0 35.0 37.0 7 36.14175 37.0 37.0 37.0 35.0 37.0 8 36.1355 37.0 37.0 37.0 35.0 37.0 9 37.86125 39.0 38.0 39.0 35.0 39.0 10 37.86425 39.0 38.0 39.0 35.0 39.0 11 37.89275 39.0 38.0 39.0 35.0 39.0 12 37.834 39.0 38.0 39.0 35.0 39.0 13 37.79225 39.0 38.0 39.0 35.0 39.0 14 39.16875 41.0 39.0 41.0 36.0 41.0 15 39.25825 40.0 39.0 41.0 36.0 41.0 16 39.16575 40.0 39.0 41.0 36.0 41.0 17 39.169 40.0 39.0 41.0 36.0 41.0 18 39.187 40.0 39.0 41.0 36.0 41.0 19 39.31225 41.0 39.0 41.0 36.0 41.0 20 39.20725 41.0 39.0 41.0 36.0 41.0 21 39.16525 41.0 39.0 41.0 36.0 41.0 22 39.108 40.0 39.0 41.0 36.0 41.0 23 39.163 40.0 39.0 41.0 36.0 41.0 24 39.1115 40.0 39.0 41.0 36.0 41.0 25 39.0915 40.0 39.0 41.0 36.0 41.0 26 39.0465 40.0 39.0 41.0 36.0 41.0 27 39.094 40.0 39.0 41.0 36.0 41.0 28 39.13025 40.0 39.0 41.0 36.0 41.0 29 39.0595 40.0 39.0 41.0 36.0 41.0 30 38.88325 40.0 38.0 41.0 35.0 41.0 31 39.014 40.0 39.0 41.0 36.0 41.0 32 38.95675 40.0 39.0 41.0 35.0 41.0 33 38.86425 40.0 39.0 41.0 35.0 41.0 34 38.53575 40.0 38.0 41.0 34.0 41.0 35 38.768 40.0 38.0 41.0 35.0 41.0 36 38.5765 40.0 38.0 41.0 35.0 41.0 37 38.61725 40.0 38.0 41.0 35.0 41.0 38 38.508 40.0 38.0 41.0 34.0 41.0 39 38.503 40.0 38.0 41.0 34.0 41.0 40 38.43025 40.0 38.0 41.0 34.0 41.0 41 38.42375 40.0 38.0 41.0 34.0 41.0 42 38.19275 40.0 38.0 41.0 33.0 41.0 43 38.141 40.0 38.0 41.0 33.0 41.0 44 38.13325 40.0 38.0 41.0 33.0 41.0 45 38.1535 40.0 38.0 41.0 33.0 41.0 46 38.0555 40.0 38.0 41.0 33.0 41.0 47 37.8695 40.0 37.0 41.0 33.0 41.0 48 37.86475 40.0 37.0 41.0 33.0 41.0 49 37.9085 40.0 37.0 41.0 33.0 41.0 50 37.97775 40.0 37.0 41.0 33.0 41.0 51 37.82775 40.0 37.0 41.0 33.0 41.0 52 36.627 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2205 1 0.0 2205 2 0.0 2205 3 0.0 2205 4 0.0 2205 5 0.0 2205 6 0.0 2205 7 0.0 2205 8 0.0 2205 9 0.0 2205 10 0.0 2205 11 0.0 2205 12 0.0 2205 13 0.0 2205 14 0.0 2205 15 0.0 2205 16 0.0 2205 17 0.0 2205 18 0.0 2205 19 0.0 2205 20 0.0 2205 21 0.0 2205 22 0.0 2205 23 0.0 2205 24 0.0 2205 25 0.0 2205 26 0.0 2205 27 0.0 2205 28 0.0 2205 29 0.0 2205 30 0.0 2205 31 0.0 2205 32 0.0 2205 33 0.0 2205 34 0.0 2205 35 0.0 2205 36 0.0 2205 37 0.0 2205 38 0.0 2205 39 0.0 2205 40 0.0 2205 41 0.0 2205 42 0.0 2205 43 0.0 2205 44 0.0 2205 45 0.0 2205 46 0.0 2205 47 0.0 2205 48 0.0 2205 49 0.0 2205 50 0.0 2205 51 0.0 2205 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 2.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 4.0 24 6.0 25 10.0 26 8.0 27 15.0 28 18.0 29 33.0 30 34.0 31 52.0 32 57.0 33 91.0 34 120.0 35 132.0 36 221.0 37 349.0 38 724.0 39 2109.0 40 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.47047047047047 14.214214214214213 5.555555555555555 34.75975975975976 2 22.8 18.0 34.150000000000006 25.05 3 17.849999999999998 22.975 26.950000000000003 32.225 4 23.7 29.15 23.425 23.724999999999998 5 22.75 33.625 23.549999999999997 20.075000000000003 6 20.225 32.5 24.65 22.625 7 17.075000000000003 20.875 41.75 20.3 8 18.35 22.6 29.375 29.675 9 17.75 19.775000000000002 33.975 28.499999999999996 10 19.950000000000003 35.225 24.0 20.825 11 24.5 26.950000000000003 20.150000000000002 28.4 12 22.875 21.7 25.324999999999996 30.099999999999998 13 21.6 25.8 27.575 25.025 14 22.275 26.3 26.674999999999997 24.75 15 21.125 25.650000000000002 27.400000000000002 25.825 16 20.7 26.625 27.075 25.6 17 21.75 26.375 27.400000000000002 24.474999999999998 18 22.075 25.3 27.700000000000003 24.925 19 21.45 26.700000000000003 26.424999999999997 25.424999999999997 20 22.15 26.35 26.200000000000003 25.3 21 22.55563890972743 24.8062015503876 26.70667666916729 25.93148287071768 22 22.475 25.174999999999997 26.35 26.0 23 22.7 25.75 25.124999999999996 26.424999999999997 24 21.4 24.8 26.775 27.025 25 22.275 25.8 26.424999999999997 25.5 26 22.525000000000002 26.275 26.150000000000002 25.05 27 22.7 25.074999999999996 25.374999999999996 26.85 28 23.3 25.374999999999996 25.6 25.724999999999998 29 21.75 25.275 25.924999999999997 27.05 30 20.724999999999998 26.55 26.650000000000002 26.075 31 22.650000000000002 25.900000000000002 24.825 26.625 32 22.55 24.375 26.075 27.0 33 21.2 25.674999999999997 27.0 26.125 34 22.975 24.0 25.974999999999998 27.05 35 22.975 24.675 25.674999999999997 26.674999999999997 36 20.775 25.8 26.450000000000003 26.974999999999998 37 23.05 25.6 25.324999999999996 26.025 38 21.45 26.05 25.874999999999996 26.625 39 21.275 24.4 26.75 27.575 40 22.325 25.074999999999996 27.200000000000003 25.4 41 23.7 25.575 25.7 25.025 42 22.325 24.775 25.7 27.200000000000003 43 22.1 25.874999999999996 25.525 26.5 44 22.650000000000002 24.474999999999998 26.424999999999997 26.450000000000003 45 23.225 24.525 24.825 27.425 46 23.53088272068017 24.081020255063766 25.906476619154787 26.481620405101275 47 22.411205602801402 25.362681340670335 25.83791895947974 26.388194097048522 48 22.28614307153577 24.337168584292147 26.613306653326664 26.76338169084542 49 22.9057264316079 24.831207801950487 25.731432858214554 26.531632908227053 50 21.635817908954476 24.88744372186093 26.863431715857928 26.613306653326664 51 22.15 24.099999999999998 27.275 26.474999999999998 52 23.849999999999998 24.125 25.55 26.474999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 3.5 23 6.0 24 6.5 25 7.0 26 10.5 27 14.0 28 23.0 29 32.0 30 43.0 31 54.0 32 56.5 33 59.0 34 74.0 35 89.0 36 100.5 37 112.0 38 131.0 39 174.0 40 198.0 41 216.5 42 235.0 43 285.5 44 336.0 45 353.5 46 371.0 47 360.0 48 349.0 49 375.0 50 401.0 51 398.5 52 396.0 53 357.0 54 318.0 55 295.0 56 272.0 57 232.5 58 193.0 59 172.0 60 151.0 61 130.0 62 109.0 63 75.0 64 41.0 65 41.0 66 36.0 67 31.0 68 21.5 69 12.0 70 10.0 71 8.0 72 5.0 73 2.0 74 3.0 75 4.0 76 3.0 77 2.0 78 3.0 79 4.0 80 2.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.025 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.05 48 0.05 49 0.025 50 0.05 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24337957124843 98.375 2 0.6557377049180327 1.3 3 0.07566204287515763 0.22499999999999998 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra Read 200000 spots for SRR5423476.sra Written 200000 spots for SRR5423476.sra SRR ids: ['SRR5423476.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3uteva7e SRR5423476.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423476 file size 703956 SRR5423476 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423476 SRR5423476_1.fastq Input file: SRR5423476_1.fastq trimmed: SRR5423476-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 16:18:41 2025 >> started Wed Feb 12 16:18:44 2025 >> done (2.773s) 4000000 reads processed; of these: 214 ( 0.01%) short reads filtered out after trimming by size control 101 ( 0.00%) empty reads filtered out after trimming by size control 3999685 (99.99%) reads available; of these: 55644 ( 1.39%) trimmed reads available after processing 3944041 (98.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 12 0.00% 21 2 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 3 0.00% 26 2 0.00% 27 1 0.00% 28 8 0.00% 29 4 0.00% 30 4 0.00% 31 13 0.00% 32 14 0.00% 33 17 0.00% 34 21 0.00% 35 20 0.00% 36 24 0.00% 37 35 0.00% 38 32 0.00% 39 38 0.00% 40 60 0.00% 41 92 0.00% 42 87 0.00% 43 127 0.00% 44 159 0.00% 45 283 0.01% 46 404 0.01% 47 567 0.01% 48 999 0.02% 49 2079 0.05% 50 6128 0.15% 51 44396 1.11% 52 3944041 98.61% 3999685 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=26 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=159.68 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=19.6 sequence=CTTCTTCTTCTC Started job on | Feb 12 16:18:54 Started mapping on | Feb 12 16:18:54 Finished on | Feb 12 16:18:59 Mapping speed, Million of reads per hour | 2879.77 Number of input reads | 3999685 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3592507 Uniquely mapped reads % | 89.82% Average mapped length | 51.85 Number of splices: Total | 452394 Number of splices: Annotated (sjdb) | 447194 Number of splices: GT/AG | 445016 Number of splices: GC/AG | 6559 Number of splices: AT/AC | 312 Number of splices: Non-canonical | 507 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313470 % of reads mapped to multiple loci | 7.84% Number of reads mapped to too many loci | 79932 % of reads mapped to too many loci | 2.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.34% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 93708 93708 93708 N_multimapping 313470 313470 313470 N_noFeature 110124 3558644 123121 N_ambiguous 36148 57 15245 UnstrandedReadsAssigned:3446235 PositiveStrandReadsAssigned:33806 NegativeStrandReadsAssigned:3454141 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423476 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423476-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,685 reads, 3,693,322 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,031 rounds 52401 SRR5423476.ke.tsv 34699 SRR5423476.se.tsv 87100 total ==> SRR5423476.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 51 8.08517 Potri.005G024800.1.v4.1 1035 936 3 0.975078 Potri.004G059700.1.v4.1 961 862 7 2.4705 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 46.4504 4.96882 Potri.016G087400.1.v4.1 270 171 168 298.887 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 2.72688 0.495569 Potri.012G127500.1.v4.1 977 878 189 65.4879 ==> SRR5423476.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 78 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423476 completed mapping pipeline successfully