Starting /dee2/code/volunteer_pipeline.sh SRR5423477 current disk space = 3051950989312 free memory = 1511569696 SRR5423477 SRAfilesize fdb87518f45c19df6b807784e8b82366 SRR5423477.sra SRR5423477.sra file validated SRR5423477 is single end SRR5423477 is conventional basespace SRR5423477 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423477_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68075 34.0 31.0 34.0 31.0 34.0 2 32.81825 34.0 31.0 34.0 31.0 34.0 3 32.8405 34.0 31.0 34.0 31.0 34.0 4 36.2015 37.0 37.0 37.0 35.0 37.0 5 36.24025 37.0 37.0 37.0 35.0 37.0 6 36.14075 37.0 37.0 37.0 35.0 37.0 7 36.13925 37.0 36.0 37.0 35.0 37.0 8 36.1625 37.0 37.0 37.0 35.0 37.0 9 37.80425 39.0 38.0 39.0 35.0 39.0 10 37.879 39.0 38.0 39.0 35.0 39.0 11 37.864 39.0 38.0 39.0 35.0 39.0 12 37.8835 39.0 38.0 39.0 35.0 39.0 13 37.804 39.0 38.0 39.0 35.0 39.0 14 39.2425 41.0 39.0 41.0 36.0 41.0 15 39.33775 41.0 39.0 41.0 36.0 41.0 16 39.312 41.0 39.0 41.0 36.0 41.0 17 39.33425 41.0 39.0 41.0 36.0 41.0 18 39.31975 41.0 39.0 41.0 36.0 41.0 19 39.126 40.0 39.0 41.0 36.0 41.0 20 39.19075 40.0 39.0 41.0 36.0 41.0 21 39.1885 40.0 39.0 41.0 36.0 41.0 22 39.2535 40.0 39.0 41.0 36.0 41.0 23 39.05 40.0 39.0 41.0 36.0 41.0 24 39.10425 40.0 39.0 41.0 36.0 41.0 25 39.04725 40.0 39.0 41.0 36.0 41.0 26 39.10775 40.0 39.0 41.0 36.0 41.0 27 39.067 40.0 39.0 41.0 36.0 41.0 28 39.033 40.0 39.0 41.0 36.0 41.0 29 38.9155 40.0 39.0 41.0 35.0 41.0 30 38.8855 40.0 39.0 41.0 35.0 41.0 31 38.88425 40.0 39.0 41.0 35.0 41.0 32 38.8535 40.0 38.0 41.0 35.0 41.0 33 38.6695 40.0 38.0 41.0 35.0 41.0 34 38.74225 40.0 38.0 41.0 35.0 41.0 35 38.65175 40.0 38.0 41.0 35.0 41.0 36 38.52725 40.0 38.0 41.0 34.0 41.0 37 38.564 40.0 38.0 41.0 34.0 41.0 38 38.47125 40.0 38.0 41.0 34.0 41.0 39 38.487 40.0 38.0 41.0 34.0 41.0 40 38.47075 40.0 38.0 41.0 34.0 41.0 41 38.471 40.0 38.0 41.0 34.0 41.0 42 38.39275 40.0 38.0 41.0 34.0 41.0 43 38.12225 40.0 38.0 41.0 33.0 41.0 44 38.152 40.0 38.0 41.0 33.0 41.0 45 37.99275 40.0 38.0 41.0 33.0 41.0 46 37.97525 40.0 38.0 41.0 33.0 41.0 47 38.0165 40.0 38.0 41.0 33.0 41.0 48 37.83725 40.0 37.0 41.0 33.0 41.0 49 37.68925 40.0 37.0 41.0 32.0 41.0 50 37.57925 40.0 37.0 41.0 32.0 41.0 51 37.779 40.0 37.0 41.0 33.0 41.0 52 36.20475 39.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2301 1 0.0 2301 2 0.0 2301 3 0.0 2301 4 0.0 2301 5 0.0 2301 6 0.0 2301 7 0.0 2301 8 0.0 2301 9 0.0 2301 10 0.0 2301 11 0.0 2301 12 0.0 2301 13 0.0 2301 14 0.0 2301 15 0.0 2301 16 0.0 2301 17 0.0 2301 18 0.0 2301 19 0.0 2301 20 0.0 2301 21 0.0 2301 22 0.0 2301 23 0.0 2301 24 0.0 2301 25 0.0 2301 26 0.0 2301 27 0.0 2301 28 0.0 2301 29 0.0 2301 30 0.0 2301 31 0.0 2301 32 0.0 2301 33 0.0 2301 34 0.0 2301 35 0.0 2301 36 0.0 2301 37 0.0 2301 38 0.0 2301 39 0.0 2301 40 0.0 2301 41 0.0 2301 42 0.0 2301 43 0.0 2301 44 0.0 2301 45 0.0 2301 46 0.0 2301 47 0.0 2301 48 0.0 2301 49 0.0 2301 50 0.0 2301 51 0.0 2301 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 2.0 21 1.0 22 0.0 23 5.0 24 7.0 25 6.0 26 6.0 27 21.0 28 19.0 29 26.0 30 31.0 31 44.0 32 80.0 33 96.0 34 121.0 35 171.0 36 223.0 37 330.0 38 674.0 39 2121.0 40 12.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.39719859929965 14.032016008004003 6.503251625812906 35.06753376688344 2 22.525000000000002 16.325 35.699999999999996 25.45 3 18.875 21.275 27.125 32.725 4 24.5 29.675 21.925 23.9 5 22.95 33.475 22.875 20.7 6 20.05 32.95 23.35 23.65 7 15.4 23.175 41.449999999999996 19.975 8 19.5 20.25 29.049999999999997 31.2 9 17.549999999999997 21.475 31.724999999999998 29.25 10 20.0 36.65 23.925 19.425 11 25.35 23.849999999999998 20.95 29.849999999999998 12 22.375 21.475 26.1 30.049999999999997 13 21.45 27.125 27.650000000000002 23.775 14 20.724999999999998 25.1 28.349999999999998 25.825 15 20.775 25.624999999999996 26.025 27.575 16 21.95 26.400000000000002 26.825 24.825 17 22.175 25.35 27.3 25.174999999999997 18 21.575 26.325 26.224999999999998 25.874999999999996 19 22.975 25.95 25.95 25.124999999999996 20 22.125 25.174999999999997 26.0 26.700000000000003 21 21.9 25.324999999999996 25.5 27.275 22 22.650000000000002 26.525 25.5 25.324999999999996 23 22.225 26.1 26.375 25.3 24 21.275 25.45 25.924999999999997 27.35 25 22.875 26.950000000000003 24.925 25.25 26 22.3 24.325 26.875 26.5 27 21.8 25.674999999999997 27.05 25.474999999999998 28 23.375 24.425 25.974999999999998 26.224999999999998 29 22.6 26.1 26.125 25.174999999999997 30 22.525000000000002 24.85 25.25 27.375 31 22.675 25.674999999999997 25.2 26.450000000000003 32 22.025 26.150000000000002 25.874999999999996 25.95 33 21.9 25.15 26.3 26.650000000000002 34 20.925 25.95 26.575 26.55 35 22.775000000000002 24.925 25.974999999999998 26.325 36 22.075 23.7 26.25 27.975 37 22.475 25.75 26.200000000000003 25.575 38 22.375 24.575 24.925 28.125 39 20.925 24.4 27.125 27.55 40 22.825 24.775 26.6 25.8 41 22.6 24.099999999999998 26.75 26.55 42 22.025 25.45 26.625 25.900000000000002 43 23.25 24.45 26.575 25.724999999999998 44 22.325 24.125 26.424999999999997 27.125 45 22.7 23.9 26.625 26.775 46 22.73068267066767 25.806451612903224 25.63140785196299 25.831457864466117 47 23.830957739434858 24.131032758189548 26.356589147286826 25.681420355088775 48 22.280570142535634 23.755938984746187 26.356589147286826 27.60690172543136 49 22.50562640660165 25.63140785196299 24.656164041010253 27.206801700425103 50 21.76088044022011 24.662331165582792 26.113056528264135 27.463731865932967 51 22.825 23.525 26.924999999999997 26.724999999999998 52 24.0 24.875 25.324999999999996 25.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.5 15 3.0 16 1.5 17 0.0 18 0.0 19 0.0 20 2.5 21 5.0 22 5.0 23 5.0 24 8.0 25 11.0 26 12.0 27 13.0 28 21.5 29 30.0 30 31.0 31 32.0 32 44.5 33 57.0 34 69.5 35 82.0 36 99.0 37 116.0 38 133.0 39 180.0 40 210.0 41 232.5 42 255.0 43 279.5 44 304.0 45 332.5 46 361.0 47 364.5 48 368.0 49 369.5 50 371.0 51 378.0 52 385.0 53 353.0 54 321.0 55 306.0 56 291.0 57 243.5 58 196.0 59 180.5 60 165.0 61 131.5 62 98.0 63 79.5 64 52.0 65 43.0 66 30.0 67 17.0 68 20.5 69 24.0 70 16.0 71 8.0 72 8.0 73 8.0 74 5.5 75 3.0 76 3.5 77 4.0 78 3.0 79 2.0 80 1.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.025 48 0.025 49 0.025 50 0.05 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78357830714648 97.45 2 1.1403953370501774 2.25 3 0.025342118601115054 0.075 4 0.025342118601115054 0.1 5 0.025342118601115054 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGGCAAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCAGCCGTAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra Read 200000 spots for SRR5423477.sra Written 200000 spots for SRR5423477.sra SRR ids: ['SRR5423477.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n7pv98lm SRR5423477.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423477 file size 703971 SRR5423477 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423477 SRR5423477_1.fastq Input file: SRR5423477_1.fastq trimmed: SRR5423477-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 16:06:33 2025 >> started Wed Feb 12 16:06:35 2025 >> done (1.660s) 4000000 reads processed; of these: 193 ( 0.00%) short reads filtered out after trimming by size control 92 ( 0.00%) empty reads filtered out after trimming by size control 3999715 (99.99%) reads available; of these: 52299 ( 1.31%) trimmed reads available after processing 3947416 (98.69%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 5 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 6 0.00% 28 3 0.00% 29 1 0.00% 30 6 0.00% 31 11 0.00% 32 13 0.00% 33 14 0.00% 34 16 0.00% 35 17 0.00% 36 15 0.00% 37 27 0.00% 38 30 0.00% 39 43 0.00% 40 60 0.00% 41 70 0.00% 42 92 0.00% 43 128 0.00% 44 180 0.00% 45 269 0.01% 46 365 0.01% 47 519 0.01% 48 967 0.02% 49 2029 0.05% 50 5560 0.14% 51 41839 1.05% 52 3947416 98.69% 3999715 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=31 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=153.40 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=19.7 sequence=CTTCTTCTTCTC Started job on | Feb 12 16:06:49 Started mapping on | Feb 12 16:06:49 Finished on | Feb 12 16:06:54 Mapping speed, Million of reads per hour | 2879.79 Number of input reads | 3999715 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3591598 Uniquely mapped reads % | 89.80% Average mapped length | 51.85 Number of splices: Total | 452156 Number of splices: Annotated (sjdb) | 447062 Number of splices: GT/AG | 444886 Number of splices: GC/AG | 6443 Number of splices: AT/AC | 321 Number of splices: Non-canonical | 506 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314521 % of reads mapped to multiple loci | 7.86% Number of reads mapped to too many loci | 79687 % of reads mapped to too many loci | 1.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.34% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 93596 93596 93596 N_multimapping 314521 314521 314521 N_noFeature 109032 3557739 122233 N_ambiguous 35939 59 15239 UnstrandedReadsAssigned:3446627 PositiveStrandReadsAssigned:33800 NegativeStrandReadsAssigned:3454126 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423477 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423477-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,715 reads, 3,696,657 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52401 SRR5423477.ke.tsv 34699 SRR5423477.se.tsv 87100 total ==> SRR5423477.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 54 8.56471 Potri.005G024800.1.v4.1 1035 936 1 0.325176 Potri.004G059700.1.v4.1 961 862 3 1.05927 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 49.3207 5.27829 Potri.016G087400.1.v4.1 270 171 128 227.828 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.181819 Potri.012G127500.1.v4.1 977 878 195 67.598 ==> SRR5423477.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 94 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423477 completed mapping pipeline successfully