Starting /dee2/code/volunteer_pipeline.sh SRR5423478 current disk space = 3051689480192 free memory = 1443457264 SRR5423478 SRAfilesize b751eb4f8ee33ab83dec18e21da218e8 SRR5423478.sra SRR5423478.sra file validated SRR5423478 is single end SRR5423478 is conventional basespace SRR5423478 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423478_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4365 31.0 31.0 34.0 28.0 34.0 2 31.788 31.0 31.0 34.0 30.0 34.0 3 31.835 33.0 31.0 34.0 30.0 34.0 4 32.405 35.0 32.0 37.0 19.0 37.0 5 34.5215 35.0 35.0 37.0 30.0 37.0 6 35.0825 37.0 35.0 37.0 32.0 37.0 7 35.56 37.0 35.0 37.0 33.0 37.0 8 35.56725 37.0 35.0 37.0 33.0 37.0 9 37.3625 39.0 37.0 39.0 34.0 39.0 10 37.33475 39.0 37.0 39.0 34.0 39.0 11 37.33175 39.0 37.0 39.0 34.0 39.0 12 37.24675 39.0 37.0 39.0 33.0 39.0 13 37.1565 39.0 37.0 39.0 33.0 39.0 14 38.42525 40.0 38.0 41.0 34.0 41.0 15 38.46825 40.0 38.0 41.0 34.0 41.0 16 38.413 40.0 38.0 41.0 33.0 41.0 17 38.5715 40.0 38.0 41.0 34.0 41.0 18 38.48225 40.0 38.0 41.0 34.0 41.0 19 38.45175 40.0 38.0 41.0 34.0 41.0 20 38.4045 40.0 38.0 41.0 34.0 41.0 21 38.51725 40.0 38.0 41.0 34.0 41.0 22 38.45025 40.0 38.0 41.0 34.0 41.0 23 38.44 40.0 38.0 41.0 34.0 41.0 24 38.48 40.0 38.0 41.0 34.0 41.0 25 38.283 40.0 38.0 41.0 33.0 41.0 26 38.378 40.0 38.0 41.0 34.0 41.0 27 38.46725 40.0 38.0 41.0 34.0 41.0 28 38.40125 40.0 38.0 41.0 34.0 41.0 29 38.36525 40.0 38.0 41.0 34.0 41.0 30 38.179 40.0 38.0 41.0 33.0 41.0 31 38.10525 40.0 38.0 41.0 33.0 41.0 32 38.164 40.0 38.0 41.0 33.0 41.0 33 38.2325 40.0 38.0 41.0 34.0 41.0 34 38.05775 40.0 38.0 41.0 33.0 41.0 35 37.98325 40.0 37.0 41.0 33.0 41.0 36 38.02125 40.0 38.0 41.0 33.0 41.0 37 37.94375 40.0 37.0 41.0 33.0 41.0 38 37.95775 40.0 37.0 41.0 33.0 41.0 39 37.82125 40.0 37.0 41.0 33.0 41.0 40 38.004 40.0 37.0 41.0 33.0 41.0 41 37.9115 40.0 37.0 41.0 33.0 41.0 42 37.7085 40.0 37.0 41.0 32.0 41.0 43 37.7625 40.0 37.0 41.0 32.0 41.0 44 37.689 40.0 37.0 41.0 32.0 41.0 45 37.60125 40.0 37.0 41.0 32.0 41.0 46 37.5155 40.0 37.0 41.0 32.0 41.0 47 37.3165 40.0 36.0 41.0 31.0 41.0 48 37.2945 39.0 36.0 41.0 31.0 41.0 49 37.22025 39.0 36.0 41.0 31.0 41.0 50 37.28125 39.0 36.0 41.0 31.0 41.0 51 37.1625 39.0 36.0 41.0 31.0 41.0 52 36.3045 39.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2315 1 0.0 2315 2 0.0 2315 3 0.0 2315 4 0.0 2315 5 0.0 2315 6 0.0 2315 7 0.0 2315 8 0.0 2315 9 0.0 2315 10 0.0 2315 11 0.0 2315 12 0.0 2315 13 0.0 2315 14 0.0 2315 15 0.0 2315 16 0.0 2315 17 0.0 2315 18 0.0 2315 19 0.0 2315 20 0.0 2315 21 0.0 2315 22 0.0 2315 23 0.0 2315 24 0.0 2315 25 0.0 2315 26 0.0 2315 27 0.0 2315 28 0.0 2315 29 0.0 2315 30 0.0 2315 31 0.0 2315 32 0.0 2315 33 0.0 2315 34 0.0 2315 35 0.0 2315 36 0.0 2315 37 0.0 2315 38 0.0 2315 39 0.0 2315 40 0.0 2315 41 0.0 2315 42 0.0 2315 43 0.0 2315 44 0.0 2315 45 0.0 2315 46 0.0 2315 47 0.0 2315 48 0.0 2315 49 0.0 2315 50 0.0 2315 51 0.0 2315 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 2.0 23 4.0 24 7.0 25 6.0 26 17.0 27 18.0 28 35.0 29 46.0 30 49.0 31 72.0 32 130.0 33 145.0 34 196.0 35 243.0 36 334.0 37 453.0 38 800.0 39 1434.0 40 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.25 13.55 6.0249999999999995 36.175000000000004 2 21.725 18.8 34.475 25.0 3 20.7 21.65 26.974999999999998 30.675 4 24.224999999999998 29.049999999999997 23.325000000000003 23.400000000000002 5 22.825 34.875 22.725 19.575 6 19.925 32.75 24.95 22.375 7 15.925 21.099999999999998 42.625 20.349999999999998 8 17.525 20.875 30.875000000000004 30.725 9 18.975 20.150000000000002 32.5 28.375 10 19.475 36.025 24.325 20.175 11 26.3 25.6 20.474999999999998 27.625 12 24.474999999999998 21.425 26.150000000000002 27.950000000000003 13 20.474999999999998 24.8 28.225 26.5 14 20.4 26.400000000000002 27.925 25.275 15 21.05 25.15 27.250000000000004 26.55 16 22.025 25.525 27.425 25.025 17 23.175 25.3 25.7 25.825 18 20.5 25.4 27.200000000000003 26.900000000000002 19 21.25 27.474999999999998 25.05 26.224999999999998 20 21.95 25.7 27.925 24.425 21 20.849999999999998 26.424999999999997 26.924999999999997 25.8 22 22.125 26.5 26.05 25.324999999999996 23 20.925 25.6 27.875 25.6 24 21.875 24.975 27.1 26.05 25 21.349999999999998 24.95 26.275 27.425 26 21.125 25.525 27.55 25.8 27 21.099999999999998 24.65 27.575 26.674999999999997 28 22.375 25.85 26.05 25.724999999999998 29 22.675 24.925 26.325 26.075 30 21.55 24.975 26.875 26.6 31 21.625 25.55 25.624999999999996 27.200000000000003 32 21.675 25.0 27.775 25.55 33 22.925 23.7 27.175 26.200000000000003 34 22.625 24.65 26.75 25.974999999999998 35 22.825 24.25 27.150000000000002 25.775 36 20.849999999999998 24.725 26.724999999999998 27.700000000000003 37 21.275 25.75 25.275 27.700000000000003 38 22.075 25.15 26.625 26.150000000000002 39 21.7 25.2 25.25 27.85 40 20.45 26.0 26.85 26.700000000000003 41 22.675 25.474999999999998 27.05 24.8 42 21.75 24.05 26.8 27.400000000000002 43 21.875 24.775 25.75 27.6 44 21.825 25.95 26.0 26.224999999999998 45 21.475 23.875 26.150000000000002 28.499999999999996 46 22.425 26.200000000000003 24.525 26.85 47 22.05 25.95 26.0 26.0 48 21.8 24.275 27.0 26.924999999999997 49 23.400000000000002 24.875 24.95 26.775 50 21.725 24.25 27.425 26.6 51 22.475 24.675 26.450000000000003 26.400000000000002 52 22.900000000000002 24.6 25.525 26.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 2.5 21 3.0 22 6.0 23 9.0 24 8.0 25 7.0 26 6.5 27 6.0 28 19.5 29 33.0 30 37.0 31 41.0 32 48.0 33 55.0 34 77.5 35 100.0 36 109.5 37 119.0 38 139.0 39 177.5 40 196.0 41 237.0 42 278.0 43 290.5 44 303.0 45 336.0 46 369.0 47 392.0 48 415.0 49 397.0 50 379.0 51 388.5 52 398.0 53 358.5 54 319.0 55 293.0 56 267.0 57 214.0 58 161.0 59 145.5 60 130.0 61 112.0 62 94.0 63 80.0 64 51.5 65 37.0 66 27.5 67 18.0 68 14.5 69 11.0 70 12.0 71 13.0 72 8.0 73 3.0 74 3.5 75 4.0 76 3.0 77 2.0 78 2.0 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26952141057934 98.52499999999999 2 0.7052896725440806 1.4000000000000001 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28591 spots for SRR5423478.sra Written 28591 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra Read 28574 spots for SRR5423478.sra Written 28574 spots for SRR5423478.sra SRR ids: ['SRR5423478.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_86ifhdcf SRR5423478.sra spots: 571497 blocks: [[1, 28574], [28575, 57148], [57149, 85722], [85723, 114296], [114297, 142870], [142871, 171444], [171445, 200018], [200019, 228592], [228593, 257166], [257167, 285740], [285741, 314314], [314315, 342888], [342889, 371462], [371463, 400036], [400037, 428610], [428611, 457184], [457185, 485758], [485759, 514332], [514333, 542906], [542907, 571497]] SRR5423478 file size 100085 SRR5423478 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423478 SRR5423478_1.fastq Input file: SRR5423478_1.fastq trimmed: SRR5423478-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:46:31 2025 >> started Wed Feb 12 15:46:32 2025 >> done (0.570s) 571497 reads processed; of these: 38 ( 0.01%) short reads filtered out after trimming by size control 10 ( 0.00%) empty reads filtered out after trimming by size control 571449 (99.99%) reads available; of these: 7456 ( 1.30%) trimmed reads available after processing 563993 (98.70%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 1 0.00% 34 2 0.00% 35 3 0.00% 36 0 0.00% 37 1 0.00% 38 1 0.00% 39 2 0.00% 40 2 0.00% 41 3 0.00% 42 6 0.00% 43 8 0.00% 44 10 0.00% 45 15 0.00% 46 30 0.01% 47 44 0.01% 48 82 0.01% 49 210 0.04% 50 775 0.14% 51 6257 1.09% 52 563993 98.70% 571449 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=19 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=76.52 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=5.2 sequence=TGGTGGCTTTACTTTGGGAGGAGG Started job on | Feb 12 15:46:43 Started mapping on | Feb 12 15:46:43 Finished on | Feb 12 15:46:46 Mapping speed, Million of reads per hour | 685.74 Number of input reads | 571449 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 513537 Uniquely mapped reads % | 89.87% Average mapped length | 51.84 Number of splices: Total | 64389 Number of splices: Annotated (sjdb) | 63668 Number of splices: GT/AG | 63288 Number of splices: GC/AG | 986 Number of splices: AT/AC | 50 Number of splices: Non-canonical | 65 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 44630 % of reads mapped to multiple loci | 7.81% Number of reads mapped to too many loci | 11553 % of reads mapped to too many loci | 2.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.30% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 13282 13282 13282 N_multimapping 44630 44630 44630 N_noFeature 16118 508792 17857 N_ambiguous 5155 10 2146 UnstrandedReadsAssigned:492264 PositiveStrandReadsAssigned:4735 NegativeStrandReadsAssigned:493534 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423478 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423478-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 571,449 reads, 527,254 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 911 rounds 52401 SRR5423478.ke.tsv 34699 SRR5423478.se.tsv 87100 total ==> SRR5423478.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 9 9.99461 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 1 2.47224 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 6 4.49594 Potri.016G087400.1.v4.1 270 171 15 186.936 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 18 43.6894 ==> SRR5423478.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 6 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423478 completed mapping pipeline successfully