Starting /dee2/code/volunteer_pipeline.sh SRR5423479 current disk space = 3051951816704 free memory = 1464450876 SRR5423479 SRAfilesize 79d0b5af61e7edba65cb8b539da175de SRR5423479.sra SRR5423479.sra file validated SRR5423479 is single end SRR5423479 is conventional basespace SRR5423479 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423479_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0485 34.0 31.0 34.0 30.0 34.0 2 31.95925 34.0 31.0 34.0 30.0 34.0 3 32.614 34.0 31.0 34.0 30.0 34.0 4 36.1835 37.0 35.0 37.0 35.0 37.0 5 36.10725 37.0 37.0 37.0 35.0 37.0 6 36.2645 37.0 37.0 37.0 35.0 37.0 7 36.288 37.0 37.0 37.0 35.0 37.0 8 36.218 37.0 37.0 37.0 35.0 37.0 9 37.92125 39.0 38.0 39.0 35.0 39.0 10 37.95075 39.0 38.0 39.0 35.0 39.0 11 38.10675 39.0 38.0 39.0 37.0 39.0 12 38.0215 39.0 38.0 39.0 35.0 39.0 13 37.89575 39.0 38.0 39.0 35.0 39.0 14 39.446 41.0 39.0 41.0 36.0 41.0 15 39.3795 41.0 39.0 41.0 36.0 41.0 16 39.37475 41.0 39.0 41.0 36.0 41.0 17 39.29975 41.0 39.0 41.0 36.0 41.0 18 39.30875 41.0 39.0 41.0 36.0 41.0 19 39.295 41.0 39.0 41.0 36.0 41.0 20 39.30775 41.0 39.0 41.0 36.0 41.0 21 39.21225 41.0 39.0 41.0 36.0 41.0 22 39.304 41.0 39.0 41.0 36.0 41.0 23 39.20175 40.0 39.0 41.0 36.0 41.0 24 39.18025 41.0 39.0 41.0 36.0 41.0 25 39.1675 41.0 39.0 41.0 36.0 41.0 26 39.1495 41.0 39.0 41.0 36.0 41.0 27 39.134 40.0 39.0 41.0 36.0 41.0 28 39.064 40.0 39.0 41.0 36.0 41.0 29 39.0045 41.0 39.0 41.0 36.0 41.0 30 38.991 41.0 39.0 41.0 35.0 41.0 31 38.9025 40.0 39.0 41.0 35.0 41.0 32 38.81075 40.0 39.0 41.0 35.0 41.0 33 38.8385 40.0 39.0 41.0 35.0 41.0 34 38.77 40.0 39.0 41.0 35.0 41.0 35 38.7905 40.0 39.0 41.0 35.0 41.0 36 38.5945 40.0 38.0 41.0 34.0 41.0 37 38.52725 40.0 38.0 41.0 35.0 41.0 38 38.4295 40.0 38.0 41.0 34.0 41.0 39 38.44325 40.0 38.0 41.0 34.0 41.0 40 38.3745 40.0 38.0 41.0 34.0 41.0 41 38.24 40.0 38.0 41.0 33.0 41.0 42 38.16575 40.0 38.0 41.0 33.0 41.0 43 38.06075 40.0 38.0 41.0 33.0 41.0 44 37.903 40.0 38.0 41.0 33.0 41.0 45 37.7865 40.0 37.0 41.0 32.0 41.0 46 37.80825 40.0 37.0 41.0 33.0 41.0 47 37.7965 40.0 37.0 41.0 33.0 41.0 48 37.8055 40.0 37.0 41.0 33.0 41.0 49 37.628 40.0 37.0 41.0 32.0 41.0 50 37.55975 40.0 37.0 41.0 32.0 41.0 51 37.35 40.0 37.0 41.0 32.0 41.0 52 35.70375 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 3.0 22 0.0 23 7.0 24 5.0 25 9.0 26 15.0 27 20.0 28 26.0 29 27.0 30 40.0 31 58.0 32 69.0 33 81.0 34 103.0 35 170.0 36 201.0 37 374.0 38 759.0 39 2015.0 40 15.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.40523394131642 13.560666137985725 4.8374306106264875 32.19666931007137 2 22.8 15.2 36.0 26.0 3 18.325 20.25 28.1 33.324999999999996 4 22.575 30.225 23.974999999999998 23.225 5 23.9 33.775 23.1 19.225 6 20.349999999999998 33.25 21.875 24.525 7 16.275000000000002 22.825 41.375 19.525000000000002 8 17.150000000000002 22.025 30.425 30.4 9 18.099999999999998 19.425 32.300000000000004 30.175 10 20.25 35.775 22.675 21.3 11 25.7 23.75 20.825 29.725 12 23.325000000000003 21.425 26.5 28.749999999999996 13 22.025 25.074999999999996 27.35 25.55 14 20.775 24.975 28.549999999999997 25.7 15 21.975 24.15 26.674999999999997 27.200000000000003 16 21.775 26.650000000000002 25.35 26.224999999999998 17 21.6 25.0 27.3 26.1 18 21.125 26.525 25.900000000000002 26.450000000000003 19 22.900000000000002 26.174999999999997 25.3 25.624999999999996 20 21.349999999999998 26.05 26.625 25.974999999999998 21 22.375 24.6 26.724999999999998 26.3 22 22.5 26.25 25.4 25.85 23 22.1 24.575 27.700000000000003 25.624999999999996 24 21.85 24.6 26.125 27.425 25 22.05 26.05 25.35 26.55 26 21.975 24.55 26.85 26.625 27 20.7 25.1 26.1 28.1 28 22.325 24.95 26.3 26.424999999999997 29 21.475 26.275 25.674999999999997 26.575 30 22.55 24.474999999999998 26.35 26.625 31 21.55 26.724999999999998 25.650000000000002 26.075 32 21.25 24.675 26.224999999999998 27.85 33 21.5 25.4 26.450000000000003 26.650000000000002 34 23.275000000000002 25.0 24.95 26.775 35 21.6 25.7 26.35 26.35 36 21.825 23.75 26.25 28.175 37 22.025 24.95 26.25 26.775 38 22.45 24.925 26.625 26.0 39 22.675 24.325 25.05 27.950000000000003 40 22.625 25.674999999999997 25.874999999999996 25.825 41 22.525000000000002 24.8 26.424999999999997 26.25 42 22.375 24.85 25.924999999999997 26.85 43 23.525 25.2 24.474999999999998 26.8 44 22.375 24.05 27.35 26.224999999999998 45 22.3 22.85 26.625 28.225 46 22.225 24.15 25.95 27.675 47 21.95 25.974999999999998 26.650000000000002 25.424999999999997 48 22.725 23.775 25.2 28.299999999999997 49 23.125 26.275 25.35 25.25 50 22.58064516129032 24.23105776444111 26.331582895723933 26.85671417854464 51 21.7 24.425 26.650000000000002 27.224999999999998 52 23.599999999999998 23.95 25.45 27.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 2.0 18 1.5 19 1.0 20 3.0 21 5.0 22 4.5 23 4.0 24 6.5 25 9.0 26 8.5 27 8.0 28 15.5 29 23.0 30 34.0 31 45.0 32 52.0 33 59.0 34 69.0 35 79.0 36 102.5 37 126.0 38 139.0 39 174.5 40 197.0 41 216.0 42 235.0 43 276.5 44 318.0 45 321.0 46 324.0 47 350.0 48 376.0 49 373.0 50 370.0 51 387.0 52 404.0 53 368.0 54 332.0 55 304.5 56 277.0 57 249.5 58 222.0 59 189.5 60 157.0 61 127.5 62 98.0 63 80.0 64 52.0 65 42.0 66 33.5 67 25.0 68 19.5 69 14.0 70 12.5 71 11.0 72 9.0 73 7.0 74 5.5 75 4.0 76 3.5 77 3.0 78 3.5 79 4.0 80 3.0 81 2.0 82 1.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11593836827481 98.1 2 0.7830260166708766 1.55 3 0.050517807527153326 0.15 4 0.050517807527153326 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra Read 200000 spots for SRR5423479.sra Written 200000 spots for SRR5423479.sra SRR ids: ['SRR5423479.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_erpailuf SRR5423479.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423479 file size 703986 SRR5423479 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423479 SRR5423479_1.fastq Input file: SRR5423479_1.fastq trimmed: SRR5423479-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 16:03:16 2025 >> started Wed Feb 12 16:03:18 2025 >> done (1.651s) 4000000 reads processed; of these: 252 ( 0.01%) short reads filtered out after trimming by size control 223 ( 0.01%) empty reads filtered out after trimming by size control 3999525 (99.99%) reads available; of these: 61727 ( 1.54%) trimmed reads available after processing 3937798 (98.46%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 10 0.00% 20 8 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 2 0.00% 25 2 0.00% 26 4 0.00% 27 5 0.00% 28 13 0.00% 29 17 0.00% 30 6 0.00% 31 18 0.00% 32 31 0.00% 33 31 0.00% 34 35 0.00% 35 35 0.00% 36 60 0.00% 37 54 0.00% 38 64 0.00% 39 73 0.00% 40 100 0.00% 41 148 0.00% 42 153 0.00% 43 182 0.00% 44 275 0.01% 45 396 0.01% 46 597 0.01% 47 780 0.02% 48 1084 0.03% 49 2367 0.06% 50 6631 0.17% 51 48532 1.21% 52 3937798 98.46% 3999525 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=26 prefix-density=0.17 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=6 fanout-score=139.45 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=18.3 sequence=CTTCTTCTTCTC Started job on | Feb 12 16:03:28 Started mapping on | Feb 12 16:03:28 Finished on | Feb 12 16:03:34 Mapping speed, Million of reads per hour | 2399.72 Number of input reads | 3999525 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3494733 Uniquely mapped reads % | 87.38% Average mapped length | 51.84 Number of splices: Total | 437516 Number of splices: Annotated (sjdb) | 432376 Number of splices: GT/AG | 430284 Number of splices: GC/AG | 6428 Number of splices: AT/AC | 289 Number of splices: Non-canonical | 515 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314453 % of reads mapped to multiple loci | 7.86% Number of reads mapped to too many loci | 170467 % of reads mapped to too many loci | 4.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 190339 190339 190339 N_multimapping 314453 314453 314453 N_noFeature 129286 3459816 143374 N_ambiguous 35015 69 14144 UnstrandedReadsAssigned:3330432 PositiveStrandReadsAssigned:34848 NegativeStrandReadsAssigned:3337215 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423479 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423479-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,525 reads, 3,632,936 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52401 SRR5423479.ke.tsv 34699 SRR5423479.se.tsv 87100 total ==> SRR5423479.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 45 6.91623 Potri.005G024800.1.v4.1 1035 936 2 0.630211 Potri.004G059700.1.v4.1 961 862 10 3.42156 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 44.4389 4.60856 Potri.016G087400.1.v4.1 270 171 179 308.737 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.176188 Potri.012G127500.1.v4.1 977 878 178 59.794 ==> SRR5423479.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 81 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423479 completed mapping pipeline successfully