Starting /dee2/code/volunteer_pipeline.sh SRR5423480 current disk space = 3092709867520 free memory = 1565308308 SRR5423480 SRAfilesize f14d274acd7699fed550821a45127068 SRR5423480.sra SRR5423480.sra file validated SRR5423480 is single end SRR5423480 is conventional basespace SRR5423480 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423480_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.427 31.0 31.0 34.0 28.0 34.0 2 31.64475 31.0 31.0 34.0 30.0 34.0 3 31.8255 31.0 31.0 34.0 30.0 34.0 4 32.116 35.0 32.0 37.0 19.0 37.0 5 34.60825 35.0 35.0 37.0 32.0 37.0 6 35.20275 36.0 35.0 37.0 32.0 37.0 7 35.12775 37.0 35.0 37.0 32.0 37.0 8 35.44525 37.0 35.0 37.0 33.0 37.0 9 37.18275 39.0 37.0 39.0 33.0 39.0 10 36.87875 39.0 37.0 39.0 32.0 39.0 11 36.99375 39.0 37.0 39.0 33.0 39.0 12 37.09275 39.0 37.0 39.0 33.0 39.0 13 36.963 39.0 37.0 39.0 33.0 39.0 14 38.1115 40.0 37.0 41.0 33.0 41.0 15 38.063 40.0 37.0 41.0 33.0 41.0 16 38.23 40.0 37.0 41.0 33.0 41.0 17 38.17075 40.0 37.0 41.0 33.0 41.0 18 38.24075 40.0 37.0 41.0 33.0 41.0 19 38.17325 40.0 38.0 41.0 33.0 41.0 20 38.2715 40.0 37.0 41.0 34.0 41.0 21 38.233 40.0 37.0 41.0 33.0 41.0 22 38.26175 40.0 38.0 41.0 33.0 41.0 23 38.19325 40.0 38.0 41.0 33.0 41.0 24 38.17975 40.0 37.0 41.0 33.0 41.0 25 38.19825 40.0 37.0 41.0 33.0 41.0 26 38.01325 40.0 37.0 41.0 33.0 41.0 27 38.0265 40.0 37.0 41.0 33.0 41.0 28 37.86575 40.0 37.0 41.0 32.0 41.0 29 37.97025 40.0 37.0 41.0 32.0 41.0 30 37.925 40.0 37.0 41.0 33.0 41.0 31 37.836 40.0 37.0 41.0 33.0 41.0 32 37.95025 40.0 37.0 41.0 33.0 41.0 33 38.06075 40.0 37.0 41.0 33.0 41.0 34 37.8955 40.0 37.0 41.0 33.0 41.0 35 37.66875 40.0 37.0 41.0 32.0 41.0 36 37.854 40.0 37.0 41.0 33.0 41.0 37 37.7775 40.0 37.0 41.0 32.0 41.0 38 37.618 40.0 37.0 41.0 32.0 41.0 39 37.711 40.0 37.0 41.0 32.0 41.0 40 37.43475 40.0 37.0 41.0 31.0 41.0 41 37.43425 40.0 37.0 41.0 31.0 41.0 42 37.55025 40.0 37.0 41.0 32.0 41.0 43 37.45425 40.0 36.0 41.0 32.0 41.0 44 37.63575 40.0 37.0 41.0 32.0 41.0 45 37.46375 40.0 36.0 41.0 32.0 41.0 46 37.31225 40.0 36.0 41.0 31.0 41.0 47 37.113 39.0 36.0 41.0 31.0 41.0 48 37.1505 39.0 36.0 41.0 31.0 41.0 49 37.09825 39.0 36.0 41.0 31.0 41.0 50 37.1675 39.0 36.0 41.0 31.0 41.0 51 36.95975 39.0 35.0 41.0 31.0 41.0 52 36.353 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1116 1 0.0 1116 2 0.0 1116 3 0.0 1116 4 0.0 1116 5 0.0 1116 6 0.0 1116 7 0.0 1116 8 0.0 1116 9 0.0 1116 10 0.0 1116 11 0.0 1116 12 0.0 1116 13 0.0 1116 14 0.0 1116 15 0.0 1116 16 0.0 1116 17 0.0 1116 18 0.0 1116 19 0.0 1116 20 0.0 1116 21 0.0 1116 22 0.0 1116 23 0.0 1116 24 0.0 1116 25 0.0 1116 26 0.0 1116 27 0.0 1116 28 0.0 1116 29 0.0 1116 30 0.0 1116 31 0.0 1116 32 0.0 1116 33 0.0 1116 34 0.0 1116 35 0.0 1116 36 0.0 1116 37 0.0 1116 38 0.0 1116 39 0.0 1116 40 0.0 1116 41 0.0 1116 42 0.0 1116 43 0.0 1116 44 0.0 1116 45 0.0 1116 46 0.0 1116 47 0.0 1116 48 0.0 1116 49 0.0 1116 50 0.0 1116 51 0.0 1116 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 2.0 22 1.0 23 3.0 24 4.0 25 13.0 26 19.0 27 24.0 28 41.0 29 49.0 30 64.0 31 120.0 32 120.0 33 150.0 34 194.0 35 255.0 36 343.0 37 503.0 38 800.0 39 1286.0 40 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.871871871871875 14.88988988988989 5.155155155155155 33.08308308308308 2 23.849999999999998 16.475 34.35 25.324999999999996 3 18.275 21.475 28.050000000000004 32.2 4 24.25 27.950000000000003 24.3 23.5 5 22.525000000000002 33.725 23.125 20.625 6 19.675 33.75 22.875 23.7 7 15.4 21.85 42.55 20.200000000000003 8 18.475 21.349999999999998 29.849999999999998 30.325000000000003 9 18.2 20.674999999999997 32.175 28.95 10 19.45 37.025000000000006 23.45 20.075000000000003 11 24.625 25.275 19.525000000000002 30.575000000000003 12 22.625 21.475 26.3 29.599999999999998 13 20.8 25.1 28.549999999999997 25.55 14 22.225 25.624999999999996 26.35 25.8 15 21.95 24.8 26.724999999999998 26.525 16 21.175 25.0 26.525 27.3 17 23.275000000000002 25.3 24.775 26.650000000000002 18 22.225 24.05 27.474999999999998 26.25 19 21.9 25.424999999999997 26.400000000000002 26.275 20 21.95 25.624999999999996 26.474999999999998 25.95 21 21.975 25.0 26.275 26.75 22 21.675 25.15 26.75 26.424999999999997 23 21.4 26.775 26.0 25.825 24 21.525 24.95 26.424999999999997 27.1 25 21.475 25.775 26.275 26.474999999999998 26 21.175 24.975 26.6 27.250000000000004 27 22.675 24.85 26.05 26.424999999999997 28 21.25 25.5 26.525 26.724999999999998 29 23.225 25.874999999999996 25.900000000000002 25.0 30 23.175 23.325000000000003 25.324999999999996 28.175 31 21.9 24.25 26.224999999999998 27.625 32 22.25 24.575 26.174999999999997 27.0 33 22.325 23.45 26.1 28.125 34 22.025 24.875 25.7 27.400000000000002 35 21.525 23.599999999999998 26.85 28.025 36 22.125 24.375 25.0 28.499999999999996 37 20.875 25.474999999999998 25.525 28.125 38 21.6 25.874999999999996 26.375 26.150000000000002 39 22.675 23.525 26.025 27.775 40 21.4 24.775 26.625 27.200000000000003 41 21.925 25.900000000000002 26.5 25.674999999999997 42 23.0 24.325 26.125 26.55 43 21.425 26.625 25.924999999999997 26.025 44 23.275000000000002 23.7 25.15 27.875 45 22.125 23.7 26.775 27.400000000000002 46 21.825 25.55 26.1 26.525 47 22.650000000000002 25.0 26.025 26.325 48 22.325 24.474999999999998 25.724999999999998 27.474999999999998 49 21.25 25.674999999999997 26.625 26.450000000000003 50 22.475 24.9 25.95 26.674999999999997 51 21.224999999999998 24.9 26.200000000000003 27.675 52 22.6 24.85 26.674999999999997 25.874999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.5 19 3.0 20 2.0 21 1.0 22 3.5 23 6.0 24 8.0 25 10.0 26 10.5 27 11.0 28 16.0 29 21.0 30 27.5 31 34.0 32 49.0 33 64.0 34 65.0 35 66.0 36 81.0 37 96.0 38 133.0 39 179.0 40 188.0 41 228.0 42 268.0 43 288.5 44 309.0 45 334.0 46 359.0 47 366.0 48 373.0 49 387.5 50 402.0 51 391.0 52 380.0 53 365.0 54 350.0 55 311.0 56 272.0 57 236.0 58 200.0 59 174.5 60 149.0 61 113.0 62 77.0 63 62.5 64 48.0 65 48.0 66 38.0 67 28.0 68 28.0 69 28.0 70 20.0 71 12.0 72 14.0 73 16.0 74 9.5 75 3.0 76 3.0 77 3.0 78 2.0 79 1.0 80 0.5 81 0.0 82 1.0 83 2.0 84 1.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16771752837327 98.3 2 0.7818411097099622 1.55 3 0.05044136191677175 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra Read 200000 spots for SRR5423480.sra Written 200000 spots for SRR5423480.sra SRR ids: ['SRR5423480.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j4ri9q59 SRR5423480.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423480 file size 703949 SRR5423480 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423480 SRR5423480_1.fastq Input file: SRR5423480_1.fastq trimmed: SRR5423480-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 10:01:24 2025 >> started Thu Feb 13 10:03:30 2025 >> done (125.693s) 4000000 reads processed; of these: 269 ( 0.01%) short reads filtered out after trimming by size control 223 ( 0.01%) empty reads filtered out after trimming by size control 3999508 (99.99%) reads available; of these: 63056 ( 1.58%) trimmed reads available after processing 3936452 (98.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 6 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 3 0.00% 25 6 0.00% 26 2 0.00% 27 7 0.00% 28 17 0.00% 29 25 0.00% 30 20 0.00% 31 25 0.00% 32 48 0.00% 33 35 0.00% 34 35 0.00% 35 29 0.00% 36 36 0.00% 37 65 0.00% 38 68 0.00% 39 83 0.00% 40 96 0.00% 41 144 0.00% 42 152 0.00% 43 207 0.01% 44 242 0.01% 45 414 0.01% 46 633 0.02% 47 879 0.02% 48 1241 0.03% 49 2588 0.06% 50 7303 0.18% 51 48631 1.22% 52 3936452 98.42% 3999508 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=26 prefix-density=0.17 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=6 fanout-score=135.25 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=17.9 sequence=CTTCTTCTTCTC Started job on | Feb 13 10:14:44 Started mapping on | Feb 13 10:14:51 Finished on | Feb 13 10:58:23 Mapping speed, Million of reads per hour | 5.51 Number of input reads | 3999508 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3495813 Uniquely mapped reads % | 87.41% Average mapped length | 51.83 Number of splices: Total | 436789 Number of splices: Annotated (sjdb) | 431588 Number of splices: GT/AG | 429595 Number of splices: GC/AG | 6365 Number of splices: AT/AC | 322 Number of splices: Non-canonical | 507 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314244 % of reads mapped to multiple loci | 7.86% Number of reads mapped to too many loci | 169309 % of reads mapped to too many loci | 4.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 189451 189451 189451 N_multimapping 314244 314244 314244 N_noFeature 129018 3460055 143294 N_ambiguous 35767 59 14245 UnstrandedReadsAssigned:3331028 PositiveStrandReadsAssigned:35699 NegativeStrandReadsAssigned:3338274 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423480 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423480-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,508 reads, 3,635,232 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52401 SRR5423480.ke.tsv 34699 SRR5423480.se.tsv 87100 total ==> SRR5423480.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 48 7.3775 Potri.005G024800.1.v4.1 1035 936 1 0.315113 Potri.004G059700.1.v4.1 961 862 5 1.71082 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 40.2675 4.17607 Potri.016G087400.1.v4.1 270 171 161 277.698 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 166 55.7643 ==> SRR5423480.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 86 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423480 completed mapping pipeline successfully