Starting /dee2/code/volunteer_pipeline.sh SRR5423481 current disk space = 3092673863680 free memory = 1445844040 SRR5423481 SRAfilesize 0c4daedc0ce6e420df98565d000d812b SRR5423481.sra SRR5423481.sra file validated SRR5423481 is single end SRR5423481 is conventional basespace SRR5423481 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423481_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.83275 31.0 30.0 34.0 27.0 34.0 2 31.38225 31.0 31.0 34.0 28.0 34.0 3 31.80225 31.0 31.0 34.0 30.0 34.0 4 30.59875 35.0 28.0 37.0 16.0 37.0 5 34.05225 35.0 33.0 37.0 28.0 37.0 6 34.8585 35.0 35.0 37.0 32.0 37.0 7 35.45375 37.0 35.0 37.0 33.0 37.0 8 35.492 37.0 35.0 37.0 33.0 37.0 9 37.2895 39.0 37.0 39.0 34.0 39.0 10 37.0035 39.0 37.0 39.0 33.0 39.0 11 37.2385 39.0 37.0 39.0 34.0 39.0 12 37.12025 39.0 37.0 39.0 33.0 39.0 13 37.04225 39.0 37.0 39.0 33.0 39.0 14 38.48625 40.0 38.0 41.0 34.0 41.0 15 38.3455 40.0 38.0 41.0 33.0 41.0 16 38.2845 40.0 38.0 41.0 33.0 41.0 17 38.28425 40.0 38.0 41.0 33.0 41.0 18 38.4615 40.0 38.0 41.0 34.0 41.0 19 38.45675 40.0 38.0 41.0 34.0 41.0 20 38.36925 40.0 38.0 41.0 34.0 41.0 21 37.96825 40.0 37.0 41.0 32.0 41.0 22 38.13375 40.0 37.0 41.0 33.0 41.0 23 38.20175 40.0 38.0 41.0 34.0 41.0 24 38.4 40.0 38.0 41.0 34.0 41.0 25 38.321 40.0 38.0 41.0 34.0 41.0 26 38.1955 40.0 38.0 41.0 34.0 41.0 27 38.14025 40.0 38.0 41.0 33.0 41.0 28 38.33925 40.0 38.0 41.0 34.0 41.0 29 38.1915 40.0 38.0 41.0 33.0 41.0 30 38.158 40.0 38.0 41.0 33.0 41.0 31 38.192 40.0 38.0 41.0 33.0 41.0 32 38.216 40.0 38.0 41.0 34.0 41.0 33 38.107 40.0 38.0 41.0 33.0 41.0 34 38.09925 40.0 38.0 41.0 33.0 41.0 35 38.03825 40.0 37.0 41.0 33.0 41.0 36 37.98575 40.0 37.0 41.0 33.0 41.0 37 38.08775 40.0 37.0 41.0 33.0 41.0 38 37.80075 40.0 37.0 41.0 33.0 41.0 39 37.581 40.0 37.0 41.0 31.0 41.0 40 37.6065 40.0 37.0 41.0 32.0 41.0 41 37.61775 40.0 37.0 41.0 32.0 41.0 42 37.256 40.0 36.0 41.0 31.0 41.0 43 37.26975 39.0 36.0 41.0 31.0 41.0 44 37.449 39.0 36.0 41.0 32.0 41.0 45 37.38575 40.0 36.0 41.0 31.0 41.0 46 37.294 39.0 36.0 41.0 31.0 41.0 47 37.2735 39.0 36.0 41.0 31.0 41.0 48 37.145 39.0 36.0 41.0 31.0 41.0 49 37.26075 39.0 36.0 41.0 31.0 41.0 50 37.1485 39.0 36.0 41.0 31.0 41.0 51 36.924 39.0 35.0 41.0 31.0 41.0 52 36.18 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1216 1 0.0 1216 2 0.0 1216 3 0.0 1216 4 0.0 1216 5 0.0 1216 6 0.0 1216 7 0.0 1216 8 0.0 1216 9 0.0 1216 10 0.0 1216 11 0.0 1216 12 0.0 1216 13 0.0 1216 14 0.0 1216 15 0.0 1216 16 0.0 1216 17 0.0 1216 18 0.0 1216 19 0.0 1216 20 0.0 1216 21 0.0 1216 22 0.0 1216 23 0.0 1216 24 0.0 1216 25 0.0 1216 26 0.0 1216 27 0.0 1216 28 0.0 1216 29 0.0 1216 30 0.0 1216 31 0.0 1216 32 0.0 1216 33 0.0 1216 34 0.0 1216 35 0.0 1216 36 0.0 1216 37 0.0 1216 38 0.0 1216 39 0.0 1216 40 0.0 1216 41 0.0 1216 42 0.0 1216 43 0.0 1216 44 0.0 1216 45 0.0 1216 46 0.0 1216 47 0.0 1216 48 0.0 1216 49 0.0 1216 50 0.0 1216 51 0.0 1216 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 0.0 24 8.0 25 13.0 26 17.0 27 22.0 28 31.0 29 47.0 30 72.0 31 93.0 32 124.0 33 164.0 34 194.0 35 257.0 36 356.0 37 536.0 38 795.0 39 1261.0 40 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.73505128846635 14.36077057793345 5.42907180385289 33.47510632974731 2 22.275 16.925 34.325 26.474999999999998 3 18.675 20.849999999999998 29.125 31.35 4 23.375 27.85 26.3 22.475 5 22.375 33.300000000000004 23.474999999999998 20.849999999999998 6 19.1 32.525 24.15 24.224999999999998 7 16.375 21.425 43.175000000000004 19.025 8 17.8 21.05 30.8 30.349999999999998 9 17.974999999999998 20.424999999999997 31.4 30.2 10 20.4 36.1 24.5 19.0 11 25.525 25.224999999999998 20.375 28.875 12 21.9 21.6 26.35 30.15 13 20.599999999999998 26.125 28.4 24.875 14 21.2 25.224999999999998 27.750000000000004 25.825 15 20.9 24.15 27.425 27.525 16 22.55 26.525 26.25 24.675 17 21.325 25.85 26.700000000000003 26.125 18 21.125 24.925 26.174999999999997 27.775 19 23.05 26.950000000000003 24.625 25.374999999999996 20 21.4 26.5 26.275 25.825 21 21.975 24.5 27.3 26.224999999999998 22 23.674999999999997 26.474999999999998 24.6 25.25 23 21.099999999999998 26.200000000000003 26.200000000000003 26.5 24 21.0 24.8 26.724999999999998 27.474999999999998 25 22.3 25.05 25.25 27.400000000000002 26 21.349999999999998 24.925 26.900000000000002 26.825 27 22.275 25.55 25.3 26.875 28 21.7 26.1 25.624999999999996 26.575 29 22.3 24.45 26.775 26.474999999999998 30 22.275 25.124999999999996 26.174999999999997 26.424999999999997 31 22.325 25.224999999999998 25.174999999999997 27.275 32 22.900000000000002 23.75 26.35 27.0 33 21.8 24.775 25.924999999999997 27.500000000000004 34 22.1 26.05 25.05 26.8 35 21.224999999999998 24.575 26.825 27.375 36 20.925 25.55 27.025 26.5 37 23.075000000000003 24.75 25.35 26.825 38 22.15 23.65 28.675 25.525 39 21.775 24.05 26.400000000000002 27.775 40 23.125 25.650000000000002 25.224999999999998 26.0 41 22.95 24.025 27.825 25.2 42 21.875 24.9 26.5 26.724999999999998 43 23.425 23.45 26.150000000000002 26.974999999999998 44 22.675 23.599999999999998 27.775 25.95 45 21.5 23.200000000000003 26.35 28.95 46 22.5 24.474999999999998 25.95 27.075 47 21.6 25.45 26.85 26.1 48 22.85 24.075 26.150000000000002 26.924999999999997 49 22.650000000000002 25.624999999999996 25.924999999999997 25.8 50 22.2 24.474999999999998 27.224999999999998 26.1 51 22.71135567783892 23.486743371685844 26.638319159579787 27.163581790895446 52 22.875 25.074999999999996 24.325 27.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.5 17 3.0 18 2.0 19 1.0 20 2.0 21 3.0 22 4.5 23 6.0 24 7.5 25 9.0 26 14.0 27 19.0 28 27.0 29 35.0 30 38.5 31 42.0 32 47.0 33 52.0 34 74.0 35 96.0 36 116.5 37 137.0 38 155.0 39 180.0 40 187.0 41 210.0 42 233.0 43 256.0 44 279.0 45 313.5 46 348.0 47 352.0 48 356.0 49 374.5 50 393.0 51 395.5 52 398.0 53 361.0 54 324.0 55 297.0 56 270.0 57 226.5 58 183.0 59 157.0 60 131.0 61 121.5 62 112.0 63 84.0 64 52.0 65 48.0 66 44.0 67 40.0 68 32.5 69 25.0 70 17.5 71 10.0 72 11.0 73 12.0 74 9.5 75 7.0 76 6.5 77 6.0 78 4.5 79 3.0 80 1.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.05 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0909090909091 98.1 2 0.8333333333333334 1.6500000000000001 3 0.050505050505050504 0.15 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra Read 200000 spots for SRR5423481.sra Written 200000 spots for SRR5423481.sra SRR ids: ['SRR5423481.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nmffjlqk SRR5423481.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423481 file size 704008 SRR5423481 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423481 SRR5423481_1.fastq Input file: SRR5423481_1.fastq trimmed: SRR5423481-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 10:07:15 2025 >> started Thu Feb 13 10:13:54 2025 >> done (399.150s) 4000000 reads processed; of these: 231 ( 0.01%) short reads filtered out after trimming by size control 248 ( 0.01%) empty reads filtered out after trimming by size control 3999521 (99.99%) reads available; of these: 59967 ( 1.50%) trimmed reads available after processing 3939554 (98.50%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 9 0.00% 20 5 0.00% 21 0 0.00% 22 2 0.00% 23 0 0.00% 24 4 0.00% 25 7 0.00% 26 7 0.00% 27 5 0.00% 28 15 0.00% 29 13 0.00% 30 14 0.00% 31 22 0.00% 32 26 0.00% 33 34 0.00% 34 26 0.00% 35 29 0.00% 36 35 0.00% 37 66 0.00% 38 58 0.00% 39 69 0.00% 40 100 0.00% 41 129 0.00% 42 125 0.00% 43 170 0.00% 44 254 0.01% 45 401 0.01% 46 563 0.01% 47 671 0.02% 48 1122 0.03% 49 2318 0.06% 50 6588 0.16% 51 47072 1.18% 52 3939554 98.50% 3999521 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=26 prefix-density=0.17 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=6 fanout-score=140.50 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=18.6 sequence=CTTCTTCTTCTC Started job on | Feb 13 10:17:08 Started mapping on | Feb 13 10:17:19 Finished on | Feb 13 10:26:05 Mapping speed, Million of reads per hour | 27.37 Number of input reads | 3999521 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3495045 Uniquely mapped reads % | 87.39% Average mapped length | 51.84 Number of splices: Total | 437987 Number of splices: Annotated (sjdb) | 432853 Number of splices: GT/AG | 430624 Number of splices: GC/AG | 6503 Number of splices: AT/AC | 357 Number of splices: Non-canonical | 503 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314744 % of reads mapped to multiple loci | 7.87% Number of reads mapped to too many loci | 169787 % of reads mapped to too many loci | 4.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.49% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 189732 189732 189732 N_multimapping 314744 314744 314744 N_noFeature 128721 3460029 142756 N_ambiguous 35221 84 14177 UnstrandedReadsAssigned:3331103 PositiveStrandReadsAssigned:34932 NegativeStrandReadsAssigned:3338112 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423481 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423481-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,521 reads, 3,634,926 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,018 rounds 52401 SRR5423481.ke.tsv 34699 SRR5423481.se.tsv 87100 total ==> SRR5423481.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 43 6.60824 Potri.005G024800.1.v4.1 1035 936 2.00261 0.630975 Potri.004G059700.1.v4.1 961 862 10 3.42125 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 44.5896 4.62376 Potri.016G087400.1.v4.1 270 171 171 294.912 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.176172 Potri.012G127500.1.v4.1 977 878 178 59.7885 ==> SRR5423481.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 83 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423481 completed mapping pipeline successfully