Starting /dee2/code/volunteer_pipeline.sh SRR5423482 current disk space = 3092690579456 free memory = 1561537640 SRR5423482 SRAfilesize c2e6bd204ec08920f36cfd4326a516c0 SRR5423482.sra SRR5423482.sra file validated SRR5423482 is single end SRR5423482 is conventional basespace SRR5423482 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423482_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4335 31.0 31.0 34.0 28.0 34.0 2 31.78275 31.0 31.0 34.0 30.0 34.0 3 31.9505 33.0 31.0 34.0 30.0 34.0 4 32.6555 35.0 32.0 37.0 19.0 37.0 5 34.53575 35.0 35.0 37.0 30.0 37.0 6 35.22825 37.0 35.0 37.0 32.0 37.0 7 35.48 37.0 35.0 37.0 33.0 37.0 8 35.60125 37.0 35.0 37.0 33.0 37.0 9 37.26075 39.0 37.0 39.0 33.0 39.0 10 37.1435 39.0 37.0 39.0 33.0 39.0 11 37.214 39.0 37.0 39.0 33.0 39.0 12 37.2225 39.0 37.0 39.0 33.0 39.0 13 37.11325 39.0 37.0 39.0 33.0 39.0 14 38.43725 40.0 38.0 41.0 34.0 41.0 15 38.3805 40.0 38.0 41.0 34.0 41.0 16 38.30125 40.0 38.0 41.0 33.0 41.0 17 38.1985 40.0 37.0 41.0 33.0 41.0 18 38.289 40.0 38.0 41.0 33.0 41.0 19 38.33875 40.0 38.0 41.0 34.0 41.0 20 38.38825 40.0 38.0 41.0 34.0 41.0 21 38.39825 40.0 38.0 41.0 33.0 41.0 22 38.43225 40.0 38.0 41.0 34.0 41.0 23 38.3385 40.0 38.0 41.0 34.0 41.0 24 38.39675 40.0 38.0 41.0 34.0 41.0 25 38.2405 40.0 37.0 41.0 33.0 41.0 26 38.25625 40.0 38.0 41.0 33.0 41.0 27 38.13325 40.0 38.0 41.0 33.0 41.0 28 38.157 40.0 38.0 41.0 33.0 41.0 29 37.99975 40.0 38.0 41.0 33.0 41.0 30 38.04525 40.0 38.0 41.0 33.0 41.0 31 38.1445 40.0 38.0 41.0 34.0 41.0 32 38.0355 40.0 37.0 41.0 33.0 41.0 33 37.795 40.0 37.0 41.0 32.0 41.0 34 37.834 40.0 37.0 41.0 33.0 41.0 35 38.06725 40.0 37.0 41.0 33.0 41.0 36 37.951 40.0 37.0 41.0 33.0 41.0 37 37.85325 40.0 37.0 41.0 33.0 41.0 38 37.748 40.0 37.0 41.0 32.0 41.0 39 37.74175 40.0 37.0 41.0 32.0 41.0 40 37.60825 40.0 37.0 41.0 32.0 41.0 41 37.584 40.0 37.0 41.0 32.0 41.0 42 37.38625 40.0 36.0 41.0 31.0 41.0 43 37.53625 40.0 37.0 41.0 32.0 41.0 44 37.418 40.0 36.0 41.0 32.0 41.0 45 37.1525 39.0 36.0 41.0 31.0 41.0 46 37.2 39.0 36.0 41.0 31.0 41.0 47 37.1175 39.0 36.0 41.0 31.0 41.0 48 37.143 39.0 36.0 41.0 31.0 41.0 49 37.14075 39.0 36.0 41.0 31.0 41.0 50 37.2585 39.0 36.0 41.0 31.0 41.0 51 37.081 39.0 36.0 41.0 31.0 41.0 52 36.39375 38.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1315 1 0.0 1315 2 0.0 1315 3 0.0 1315 4 0.0 1315 5 0.0 1315 6 0.0 1315 7 0.0 1315 8 0.0 1315 9 0.0 1315 10 0.0 1315 11 0.0 1315 12 0.0 1315 13 0.0 1315 14 0.0 1315 15 0.0 1315 16 0.0 1315 17 0.0 1315 18 0.0 1315 19 0.0 1315 20 0.0 1315 21 0.0 1315 22 0.0 1315 23 0.0 1315 24 0.0 1315 25 0.0 1315 26 0.0 1315 27 0.0 1315 28 0.0 1315 29 0.0 1315 30 0.0 1315 31 0.0 1315 32 0.0 1315 33 0.0 1315 34 0.0 1315 35 0.0 1315 36 0.0 1315 37 0.0 1315 38 0.0 1315 39 0.0 1315 40 0.0 1315 41 0.0 1315 42 0.0 1315 43 0.0 1315 44 0.0 1315 45 0.0 1315 46 0.0 1315 47 0.0 1315 48 0.0 1315 49 0.0 1315 50 0.0 1315 51 0.0 1315 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 3.0 22 2.0 23 3.0 24 6.0 25 11.0 26 12.0 27 30.0 28 30.0 29 48.0 30 68.0 31 95.0 32 121.0 33 145.0 34 200.0 35 239.0 36 341.0 37 480.0 38 775.0 39 1379.0 40 10.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.96022016512384 14.435826870152615 5.754315736802602 32.849637227920944 2 21.95 17.125 34.4 26.525 3 18.975 20.775 27.675 32.574999999999996 4 23.35 28.95 25.275 22.425 5 22.425 34.2 23.3 20.075000000000003 6 20.5 33.175 23.825 22.5 7 16.275000000000002 22.2 41.375 20.150000000000002 8 16.875 20.275000000000002 31.3 31.55 9 17.8 20.025000000000002 33.4 28.775000000000002 10 20.125 36.225 23.875 19.775000000000002 11 24.349999999999998 25.775 19.55 30.325000000000003 12 23.125 21.3 26.3 29.275000000000002 13 21.3 25.275 27.925 25.5 14 20.175 26.525 27.150000000000002 26.150000000000002 15 20.674999999999997 24.875 28.050000000000004 26.400000000000002 16 22.55 26.224999999999998 26.825 24.4 17 22.275 25.974999999999998 26.75 25.0 18 21.125 25.75 26.275 26.85 19 21.4 27.925 24.6 26.075 20 21.4 24.825 26.674999999999997 27.1 21 21.224999999999998 24.65 27.85 26.275 22 21.575 25.25 26.950000000000003 26.224999999999998 23 21.475 24.349999999999998 26.950000000000003 27.224999999999998 24 22.2 24.825 26.424999999999997 26.55 25 21.6 25.924999999999997 26.174999999999997 26.3 26 21.95 24.25 27.900000000000002 25.900000000000002 27 21.75 24.925 26.625 26.700000000000003 28 23.674999999999997 25.974999999999998 24.375 25.974999999999998 29 21.65 25.924999999999997 27.1 25.324999999999996 30 20.599999999999998 26.075 26.125 27.200000000000003 31 22.3 25.275 26.05 26.375 32 22.3 23.474999999999998 28.1 26.125 33 22.0 24.575 27.150000000000002 26.275 34 21.0 24.8 27.450000000000003 26.75 35 22.8 23.3 26.55 27.35 36 20.849999999999998 25.0 26.5 27.650000000000002 37 22.55 26.6 25.575 25.275 38 22.35 24.65 26.05 26.950000000000003 39 21.45 24.925 24.8 28.825 40 21.775 25.0 26.0 27.224999999999998 41 23.375 23.724999999999998 26.400000000000002 26.5 42 21.349999999999998 24.625 27.85 26.174999999999997 43 22.2 24.175 27.0 26.625 44 22.650000000000002 24.075 25.95 27.325 45 22.2 24.65 25.900000000000002 27.250000000000004 46 23.005751437859466 26.106526631657918 25.056264066016503 25.831457864466117 47 21.975 25.15 26.275 26.6 48 20.610305152576288 23.411705852926463 26.93846923461731 29.03951975987994 49 21.75 25.4 24.95 27.900000000000002 50 22.13053263315829 24.131032758189548 26.881720430107524 26.85671417854464 51 22.25 23.025000000000002 25.825 28.9 52 22.95 24.925 25.674999999999997 26.450000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 2.0 21 3.0 22 5.0 23 7.0 24 9.5 25 12.0 26 13.0 27 14.0 28 21.5 29 29.0 30 34.5 31 40.0 32 53.0 33 66.0 34 74.5 35 83.0 36 101.5 37 120.0 38 148.5 39 194.5 40 212.0 41 223.0 42 234.0 43 267.0 44 300.0 45 317.0 46 334.0 47 367.5 48 401.0 49 393.5 50 386.0 51 383.5 52 381.0 53 350.5 54 320.0 55 294.5 56 269.0 57 221.5 58 174.0 59 154.5 60 135.0 61 115.0 62 95.0 63 89.0 64 61.0 65 39.0 66 30.0 67 21.0 68 22.0 69 23.0 70 16.0 71 9.0 72 11.5 73 14.0 74 12.5 75 11.0 76 6.5 77 2.0 78 1.0 79 0.0 80 0.5 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.0 48 0.05 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11638475132543 98.15 2 0.7826306488260539 1.55 3 0.10098459984852311 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra Read 200000 spots for SRR5423482.sra Written 200000 spots for SRR5423482.sra SRR ids: ['SRR5423482.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p1ri2fwx SRR5423482.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423482 file size 703971 SRR5423482 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423482 SRR5423482_1.fastq Input file: SRR5423482_1.fastq trimmed: SRR5423482-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 10:12:02 2025 >> started Thu Feb 13 10:20:38 2025 >> done (516.122s) 4000000 reads processed; of these: 266 ( 0.01%) short reads filtered out after trimming by size control 225 ( 0.01%) empty reads filtered out after trimming by size control 3999509 (99.99%) reads available; of these: 61244 ( 1.53%) trimmed reads available after processing 3938265 (98.47%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 4 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 3 0.00% 25 5 0.00% 26 9 0.00% 27 10 0.00% 28 15 0.00% 29 13 0.00% 30 10 0.00% 31 32 0.00% 32 44 0.00% 33 30 0.00% 34 43 0.00% 35 37 0.00% 36 33 0.00% 37 76 0.00% 38 84 0.00% 39 82 0.00% 40 102 0.00% 41 149 0.00% 42 154 0.00% 43 216 0.01% 44 294 0.01% 45 450 0.01% 46 619 0.02% 47 818 0.02% 48 1263 0.03% 49 2510 0.06% 50 6894 0.17% 51 47219 1.18% 52 3938265 98.47% 3999509 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=26 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=6 fanout-score=137.74 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=18.1 sequence=CTTCTTCTTCTC Started job on | Feb 13 10:27:31 Started mapping on | Feb 13 10:27:45 Finished on | Feb 13 10:58:20 Mapping speed, Million of reads per hour | 7.85 Number of input reads | 3999509 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3495343 Uniquely mapped reads % | 87.39% Average mapped length | 51.83 Number of splices: Total | 435830 Number of splices: Annotated (sjdb) | 430844 Number of splices: GT/AG | 428810 Number of splices: GC/AG | 6168 Number of splices: AT/AC | 321 Number of splices: Non-canonical | 531 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314627 % of reads mapped to multiple loci | 7.87% Number of reads mapped to too many loci | 169252 % of reads mapped to too many loci | 4.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 189539 189539 189539 N_multimapping 314627 314627 314627 N_noFeature 129216 3460533 143097 N_ambiguous 35327 57 14356 UnstrandedReadsAssigned:3330800 PositiveStrandReadsAssigned:34753 NegativeStrandReadsAssigned:3337890 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423482 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423482-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,509 reads, 3,623,433 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,028 rounds 52401 SRR5423482.ke.tsv 34699 SRR5423482.se.tsv 87100 total ==> SRR5423482.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 56 8.63412 Potri.005G024800.1.v4.1 1035 936 1 0.316103 Potri.004G059700.1.v4.1 961 862 4 1.37296 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 32.2137 3.35132 Potri.016G087400.1.v4.1 270 171 150 259.537 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 3 0.530238 Potri.012G127500.1.v4.1 977 878 173 58.2984 ==> SRR5423482.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 84 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423482 completed mapping pipeline successfully