Starting /dee2/code/volunteer_pipeline.sh SRR5423483 current disk space = 3051912482816 free memory = 1486595184 SRR5423483 SRAfilesize 9cdd764db29309c2f5a36910ef916c46 SRR5423483.sra SRR5423483.sra file validated SRR5423483 is single end SRR5423483 is conventional basespace SRR5423483 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423483_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1165 31.0 31.0 34.0 28.0 34.0 2 31.69175 31.0 31.0 34.0 30.0 34.0 3 31.99975 33.0 31.0 34.0 30.0 34.0 4 30.772 35.0 28.0 37.0 16.0 37.0 5 34.003 35.0 33.0 37.0 28.0 37.0 6 34.88575 35.0 35.0 37.0 32.0 37.0 7 35.35075 37.0 35.0 37.0 33.0 37.0 8 35.56825 37.0 35.0 37.0 33.0 37.0 9 37.22225 39.0 37.0 39.0 34.0 39.0 10 37.26075 39.0 37.0 39.0 34.0 39.0 11 37.325 39.0 37.0 39.0 34.0 39.0 12 37.28225 39.0 37.0 39.0 33.0 39.0 13 37.232 39.0 37.0 39.0 33.0 39.0 14 38.48625 40.0 38.0 41.0 34.0 41.0 15 38.5545 40.0 38.0 41.0 34.0 41.0 16 38.5085 40.0 38.0 41.0 34.0 41.0 17 38.5295 40.0 38.0 41.0 34.0 41.0 18 38.54975 40.0 38.0 41.0 34.0 41.0 19 38.613 40.0 38.0 41.0 34.0 41.0 20 38.52825 40.0 38.0 41.0 34.0 41.0 21 38.3595 40.0 38.0 41.0 33.0 41.0 22 38.41825 40.0 38.0 41.0 34.0 41.0 23 38.41875 40.0 38.0 41.0 34.0 41.0 24 38.498 40.0 38.0 41.0 34.0 41.0 25 38.40725 40.0 38.0 41.0 34.0 41.0 26 38.49275 40.0 38.0 41.0 34.0 41.0 27 38.38525 40.0 38.0 41.0 34.0 41.0 28 38.19925 40.0 38.0 41.0 34.0 41.0 29 38.18175 40.0 38.0 41.0 34.0 41.0 30 38.19575 40.0 38.0 41.0 33.0 41.0 31 38.056 40.0 38.0 41.0 33.0 41.0 32 38.16925 40.0 38.0 41.0 33.0 41.0 33 38.2795 40.0 38.0 41.0 34.0 41.0 34 38.0585 40.0 38.0 41.0 33.0 41.0 35 38.08675 40.0 38.0 41.0 33.0 41.0 36 38.2255 40.0 38.0 41.0 33.0 41.0 37 38.095 40.0 38.0 41.0 33.0 41.0 38 37.92325 40.0 37.0 41.0 33.0 41.0 39 37.92575 40.0 37.0 41.0 33.0 41.0 40 38.05325 40.0 37.0 41.0 33.0 41.0 41 37.9305 40.0 37.0 41.0 33.0 41.0 42 37.7465 40.0 37.0 41.0 33.0 41.0 43 37.87775 40.0 37.0 41.0 33.0 41.0 44 37.705 40.0 37.0 41.0 33.0 41.0 45 37.5065 40.0 37.0 41.0 31.0 41.0 46 37.38325 40.0 36.0 41.0 31.0 41.0 47 37.39425 40.0 36.0 41.0 31.0 41.0 48 37.292 39.0 36.0 41.0 31.0 41.0 49 37.52525 40.0 36.0 41.0 32.0 41.0 50 37.28575 39.0 36.0 41.0 31.0 41.0 51 37.3585 39.0 36.0 41.0 31.0 41.0 52 36.79075 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2114 1 0.0 2114 2 0.0 2114 3 0.0 2114 4 0.0 2114 5 0.0 2114 6 0.0 2114 7 0.0 2114 8 0.0 2114 9 0.0 2114 10 0.0 2114 11 0.0 2114 12 0.0 2114 13 0.0 2114 14 0.0 2114 15 0.0 2114 16 0.0 2114 17 0.0 2114 18 0.0 2114 19 0.0 2114 20 0.0 2114 21 0.0 2114 22 0.0 2114 23 0.0 2114 24 0.0 2114 25 0.0 2114 26 0.0 2114 27 0.0 2114 28 0.0 2114 29 0.0 2114 30 0.0 2114 31 0.0 2114 32 0.0 2114 33 0.0 2114 34 0.0 2114 35 0.0 2114 36 0.0 2114 37 0.0 2114 38 0.0 2114 39 0.0 2114 40 0.0 2114 41 0.0 2114 42 0.0 2114 43 0.0 2114 44 0.0 2114 45 0.0 2114 46 0.0 2114 47 0.0 2114 48 0.0 2114 49 0.0 2114 50 0.0 2114 51 0.0 2114 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 4.0 23 4.0 24 5.0 25 9.0 26 14.0 27 26.0 28 23.0 29 35.0 30 70.0 31 86.0 32 113.0 33 132.0 34 200.0 35 250.0 36 342.0 37 487.0 38 795.0 39 1396.0 40 7.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.77338669334667 15.382691345672836 5.952976488244122 31.89094547273637 2 22.975 16.6 34.1 26.325 3 18.2 22.2 29.049999999999997 30.55 4 23.3 27.55 25.474999999999998 23.674999999999997 5 22.425 31.874999999999996 24.7 21.0 6 19.675 33.725 23.175 23.425 7 16.175 22.25 41.699999999999996 19.875 8 17.575 20.75 31.05 30.625000000000004 9 18.025 20.974999999999998 31.4 29.599999999999998 10 20.599999999999998 34.875 24.3 20.225 11 24.25 24.55 20.8 30.4 12 21.725 21.65 25.174999999999997 31.45 13 20.575 25.0 28.475 25.95 14 20.875 23.474999999999998 28.075 27.575 15 20.825 25.025 27.275 26.875 16 21.775 26.825 25.95 25.45 17 22.6 26.25 27.200000000000003 23.95 18 21.325 24.875 26.825 26.974999999999998 19 22.075 26.474999999999998 26.674999999999997 24.775 20 22.0 25.650000000000002 27.150000000000002 25.2 21 22.25 24.375 26.75 26.625 22 21.775 25.55 25.825 26.85 23 21.925 24.975 26.05 27.05 24 21.325 25.224999999999998 27.075 26.375 25 22.3 25.174999999999997 26.025 26.5 26 22.35 24.3 25.85 27.500000000000004 27 20.9 25.575 26.575 26.950000000000003 28 21.475 25.525 25.874999999999996 27.125 29 22.0 26.174999999999997 27.1 24.725 30 22.025 24.325 27.55 26.1 31 21.95 24.85 26.200000000000003 27.0 32 22.3 25.124999999999996 25.75 26.825 33 21.575 23.525 27.975 26.924999999999997 34 21.6 25.575 26.325 26.5 35 22.25 25.05 25.85 26.85 36 21.9 23.5 25.924999999999997 28.675 37 20.8 25.45 26.575 27.175 38 21.575 24.025 27.450000000000003 26.950000000000003 39 21.575 25.374999999999996 25.374999999999996 27.675 40 22.1 23.799999999999997 27.0 27.1 41 20.474999999999998 25.374999999999996 26.650000000000002 27.500000000000004 42 21.475 23.599999999999998 27.275 27.650000000000002 43 23.175 24.2 25.874999999999996 26.75 44 21.349999999999998 24.75 27.575 26.325 45 21.175 25.324999999999996 26.674999999999997 26.825 46 22.275 24.25 26.525 26.950000000000003 47 22.88072018004501 24.281070267566893 25.6064016004001 27.231807951987996 48 21.48037009252313 25.10627656914228 26.206551637909474 27.206801700425103 49 23.775 24.7 25.974999999999998 25.55 50 22.030507626906726 25.006251562890725 26.006501625406354 26.9567391847962 51 22.900000000000002 24.125 26.5 26.474999999999998 52 23.075000000000003 24.975 25.525 26.424999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 2.0 21 3.0 22 3.5 23 4.0 24 6.0 25 8.0 26 11.0 27 14.0 28 21.5 29 29.0 30 33.5 31 38.0 32 48.5 33 59.0 34 73.0 35 87.0 36 105.0 37 123.0 38 140.5 39 177.5 40 197.0 41 236.5 42 276.0 43 285.5 44 295.0 45 312.5 46 330.0 47 362.0 48 394.0 49 398.0 50 402.0 51 391.5 52 381.0 53 350.5 54 320.0 55 289.5 56 259.0 57 237.0 58 215.0 59 173.5 60 132.0 61 111.0 62 90.0 63 78.0 64 53.5 65 41.0 66 37.0 67 33.0 68 27.0 69 21.0 70 15.0 71 9.0 72 7.5 73 6.0 74 4.5 75 3.0 76 3.5 77 4.0 78 2.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.025 48 0.025 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06589245140115 98.1 2 0.8836152486745772 1.7500000000000002 3 0.050492299924261554 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra Read 200000 spots for SRR5423483.sra Written 200000 spots for SRR5423483.sra SRR ids: ['SRR5423483.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h7vjxcbz SRR5423483.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423483 file size 703944 SRR5423483 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423483 SRR5423483_1.fastq Input file: SRR5423483_1.fastq trimmed: SRR5423483-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 16:09:25 2025 >> started Wed Feb 12 16:09:27 2025 >> done (1.922s) 4000000 reads processed; of these: 260 ( 0.01%) short reads filtered out after trimming by size control 257 ( 0.01%) empty reads filtered out after trimming by size control 3999483 (99.99%) reads available; of these: 64526 ( 1.61%) trimmed reads available after processing 3934957 (98.39%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 9 0.00% 20 13 0.00% 21 3 0.00% 22 1 0.00% 23 7 0.00% 24 3 0.00% 25 7 0.00% 26 8 0.00% 27 10 0.00% 28 13 0.00% 29 22 0.00% 30 20 0.00% 31 30 0.00% 32 51 0.00% 33 50 0.00% 34 30 0.00% 35 38 0.00% 36 43 0.00% 37 86 0.00% 38 77 0.00% 39 104 0.00% 40 157 0.00% 41 178 0.00% 42 180 0.00% 43 240 0.01% 44 306 0.01% 45 534 0.01% 46 743 0.02% 47 920 0.02% 48 1419 0.04% 49 2804 0.07% 50 7722 0.19% 51 48684 1.22% 52 3934957 98.39% 3999483 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=25 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=5 fanout-score=142.06 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=18.1 sequence=CTTCTTCTTCTC Started job on | Feb 12 16:09:37 Started mapping on | Feb 12 16:09:38 Finished on | Feb 12 16:09:42 Mapping speed, Million of reads per hour | 3599.53 Number of input reads | 3999483 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3495720 Uniquely mapped reads % | 87.40% Average mapped length | 51.83 Number of splices: Total | 436819 Number of splices: Annotated (sjdb) | 431620 Number of splices: GT/AG | 429833 Number of splices: GC/AG | 6175 Number of splices: AT/AC | 319 Number of splices: Non-canonical | 492 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 1.61 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314410 % of reads mapped to multiple loci | 7.86% Number of reads mapped to too many loci | 168490 % of reads mapped to too many loci | 4.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 189353 189353 189353 N_multimapping 314410 314410 314410 N_noFeature 128635 3460316 142847 N_ambiguous 35479 73 14242 UnstrandedReadsAssigned:3331606 PositiveStrandReadsAssigned:35331 NegativeStrandReadsAssigned:3338631 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423483 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423483-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,483 reads, 3,630,729 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR5423483.ke.tsv 34699 SRR5423483.se.tsv 87100 total ==> SRR5423483.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 45 6.92079 Potri.005G024800.1.v4.1 1035 936 1.00065 0.31552 Potri.004G059700.1.v4.1 961 862 7 2.39667 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 39.4214 4.09092 Potri.016G087400.1.v4.1 270 171 149 257.163 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.176304 Potri.012G127500.1.v4.1 977 878 160 53.7828 ==> SRR5423483.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 79 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423483 completed mapping pipeline successfully