Starting /dee2/code/volunteer_pipeline.sh SRR5423484 current disk space = 3093220016128 free memory = 1561589760 SRR5423484 SRAfilesize 1f1aab5e3989ddd520f70942d66f0c39 SRR5423484.sra SRR5423484.sra file validated SRR5423484 is single end SRR5423484 is conventional basespace SRR5423484 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423484_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5745 31.0 31.0 34.0 30.0 34.0 2 31.904 33.0 31.0 34.0 30.0 34.0 3 32.1165 34.0 31.0 34.0 30.0 34.0 4 32.944 35.0 33.0 37.0 19.0 37.0 5 34.72625 37.0 35.0 37.0 32.0 37.0 6 35.375 37.0 35.0 37.0 33.0 37.0 7 35.59425 37.0 35.0 37.0 33.0 37.0 8 35.68225 37.0 35.0 37.0 33.0 37.0 9 37.49825 39.0 37.0 39.0 35.0 39.0 10 37.327 39.0 37.0 39.0 34.0 39.0 11 37.4545 39.0 37.0 39.0 35.0 39.0 12 37.37775 39.0 37.0 39.0 34.0 39.0 13 37.43875 39.0 37.0 39.0 35.0 39.0 14 38.704 40.0 38.0 41.0 35.0 41.0 15 38.567 40.0 38.0 41.0 34.0 41.0 16 38.6595 40.0 38.0 41.0 34.0 41.0 17 38.68075 40.0 38.0 41.0 34.0 41.0 18 38.3585 40.0 38.0 41.0 33.0 41.0 19 38.69325 40.0 38.0 41.0 34.0 41.0 20 38.548 40.0 38.0 41.0 34.0 41.0 21 38.55525 40.0 38.0 41.0 34.0 41.0 22 38.56825 40.0 38.0 41.0 34.0 41.0 23 38.621 40.0 38.0 41.0 34.0 41.0 24 38.53625 40.0 38.0 41.0 34.0 41.0 25 38.53 40.0 38.0 41.0 34.0 41.0 26 38.605 40.0 38.0 41.0 34.0 41.0 27 38.35475 40.0 38.0 41.0 34.0 41.0 28 38.438 40.0 38.0 41.0 34.0 41.0 29 38.48 40.0 38.0 41.0 34.0 41.0 30 38.47675 40.0 38.0 41.0 34.0 41.0 31 38.34275 40.0 38.0 41.0 34.0 41.0 32 38.4025 40.0 38.0 41.0 34.0 41.0 33 38.184 40.0 38.0 41.0 33.0 41.0 34 38.16875 40.0 38.0 41.0 34.0 41.0 35 38.29125 40.0 38.0 41.0 34.0 41.0 36 38.1625 40.0 38.0 41.0 33.0 41.0 37 37.93475 40.0 37.0 41.0 33.0 41.0 38 38.0455 40.0 38.0 41.0 33.0 41.0 39 38.09025 40.0 37.0 41.0 33.0 41.0 40 37.93075 40.0 37.0 41.0 33.0 41.0 41 37.9825 40.0 37.0 41.0 33.0 41.0 42 37.94325 40.0 37.0 41.0 33.0 41.0 43 37.7515 40.0 37.0 41.0 33.0 41.0 44 37.80125 40.0 37.0 41.0 33.0 41.0 45 37.6415 40.0 37.0 41.0 32.0 41.0 46 37.57875 40.0 37.0 41.0 32.0 41.0 47 37.68975 40.0 37.0 41.0 32.0 41.0 48 37.6065 40.0 37.0 41.0 32.0 41.0 49 37.70475 40.0 37.0 41.0 32.0 41.0 50 37.5425 39.0 36.0 41.0 32.0 41.0 51 37.311 39.0 36.0 41.0 32.0 41.0 52 36.61125 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2214 1 0.0 2214 2 0.0 2214 3 0.0 2214 4 0.0 2214 5 0.0 2214 6 0.0 2214 7 0.0 2214 8 0.0 2214 9 0.0 2214 10 0.0 2214 11 0.0 2214 12 0.0 2214 13 0.0 2214 14 0.0 2214 15 0.0 2214 16 0.0 2214 17 0.0 2214 18 0.0 2214 19 0.0 2214 20 0.0 2214 21 0.0 2214 22 0.0 2214 23 0.0 2214 24 0.0 2214 25 0.0 2214 26 0.0 2214 27 0.0 2214 28 0.0 2214 29 0.0 2214 30 0.0 2214 31 0.0 2214 32 0.0 2214 33 0.0 2214 34 0.0 2214 35 0.0 2214 36 0.0 2214 37 0.0 2214 38 0.0 2214 39 0.0 2214 40 0.0 2214 41 0.0 2214 42 0.0 2214 43 0.0 2214 44 0.0 2214 45 0.0 2214 46 0.0 2214 47 0.0 2214 48 0.0 2214 49 0.0 2214 50 0.0 2214 51 0.0 2214 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 0.0 21 2.0 22 3.0 23 3.0 24 8.0 25 3.0 26 10.0 27 21.0 28 30.0 29 35.0 30 51.0 31 74.0 32 95.0 33 132.0 34 176.0 35 217.0 36 315.0 37 519.0 38 786.0 39 1514.0 40 3.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.28449787127473 14.775857751064361 5.634861006761834 31.304783370899074 2 22.125 15.825 35.675000000000004 26.375 3 17.175 21.6 28.275 32.95 4 22.75 27.725 26.8 22.725 5 23.724999999999998 31.724999999999998 24.224999999999998 20.325 6 19.325 31.525 24.224999999999998 24.925 7 15.675 22.8 41.0 20.525 8 17.775 21.45 31.5 29.275000000000002 9 18.575 20.225 32.875 28.325 10 20.125 36.525 23.175 20.175 11 25.275 25.324999999999996 20.65 28.749999999999996 12 22.8 21.4 26.525 29.275000000000002 13 20.875 26.3 27.675 25.15 14 21.625 25.8 27.325 25.25 15 21.9 24.2 27.325 26.575 16 22.175 25.974999999999998 25.2 26.650000000000002 17 21.8 25.124999999999996 27.325 25.75 18 20.825 24.725 26.974999999999998 27.474999999999998 19 21.325 25.424999999999997 26.924999999999997 26.325 20 22.15 25.474999999999998 26.35 26.025 21 22.3 25.650000000000002 25.575 26.474999999999998 22 21.85 26.150000000000002 26.200000000000003 25.8 23 21.575 24.8 27.0 26.625 24 21.55 25.55 26.05 26.85 25 22.525000000000002 25.674999999999997 25.974999999999998 25.825 26 22.55 25.124999999999996 26.5 25.825 27 21.55 24.175 26.575 27.700000000000003 28 23.05 25.85 24.9 26.200000000000003 29 21.9 24.7 27.0 26.400000000000002 30 21.224999999999998 23.925 26.275 28.575 31 22.5 25.3 25.374999999999996 26.825 32 22.650000000000002 24.3 25.974999999999998 27.075 33 21.625 23.25 27.200000000000003 27.925 34 22.575 25.674999999999997 25.1 26.650000000000002 35 22.825 24.575 25.55 27.05 36 21.85 24.05 25.474999999999998 28.625 37 22.625 25.75 26.05 25.575 38 22.475 24.3 26.8 26.424999999999997 39 21.75 24.825 26.650000000000002 26.775 40 24.0 25.324999999999996 24.25 26.424999999999997 41 21.8 25.3 25.6 27.3 42 23.3 24.075 26.424999999999997 26.200000000000003 43 22.825 26.174999999999997 25.650000000000002 25.35 44 22.075 24.825 26.05 27.05 45 22.2 24.45 25.575 27.775 46 22.525000000000002 25.85 25.374999999999996 26.25 47 22.25 25.324999999999996 26.0 26.424999999999997 48 21.85546386596649 24.431107776944234 26.25656414103526 27.45686421605401 49 23.3 25.45 24.875 26.375 50 22.48062015503876 23.655913978494624 26.30657664416104 27.556889222305575 51 21.475 23.724999999999998 26.05 28.749999999999996 52 22.875 24.8 25.4 26.924999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 5.5 21 9.0 22 9.5 23 10.0 24 12.0 25 14.0 26 15.5 27 17.0 28 23.0 29 29.0 30 34.5 31 40.0 32 42.0 33 44.0 34 63.5 35 83.0 36 99.5 37 116.0 38 131.0 39 163.0 40 180.0 41 209.5 42 239.0 43 277.0 44 315.0 45 330.5 46 346.0 47 363.5 48 381.0 49 389.5 50 398.0 51 388.5 52 379.0 53 350.5 54 322.0 55 299.5 56 277.0 57 239.5 58 202.0 59 177.5 60 153.0 61 125.5 62 98.0 63 80.0 64 53.5 65 45.0 66 36.5 67 28.0 68 23.5 69 19.0 70 15.0 71 11.0 72 12.5 73 14.0 74 13.0 75 12.0 76 8.5 77 5.0 78 3.0 79 1.0 80 0.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03967652261815 97.975 2 0.8339651250947688 1.6500000000000001 3 0.1263583522870862 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra Read 200000 spots for SRR5423484.sra Written 200000 spots for SRR5423484.sra SRR ids: ['SRR5423484.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__0fdyzxt SRR5423484.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423484 file size 703989 SRR5423484 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423484 SRR5423484_1.fastq Input file: SRR5423484_1.fastq trimmed: SRR5423484-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 10:17:01 2025 >> started Thu Feb 13 10:18:26 2025 >> done (84.113s) 4000000 reads processed; of these: 248 ( 0.01%) short reads filtered out after trimming by size control 240 ( 0.01%) empty reads filtered out after trimming by size control 3999512 (99.99%) reads available; of these: 58216 ( 1.46%) trimmed reads available after processing 3941296 (98.54%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 14 0.00% 20 3 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 6 0.00% 25 4 0.00% 26 5 0.00% 27 6 0.00% 28 6 0.00% 29 16 0.00% 30 10 0.00% 31 23 0.00% 32 30 0.00% 33 46 0.00% 34 29 0.00% 35 38 0.00% 36 35 0.00% 37 51 0.00% 38 72 0.00% 39 98 0.00% 40 126 0.00% 41 135 0.00% 42 146 0.00% 43 189 0.00% 44 260 0.01% 45 440 0.01% 46 599 0.01% 47 805 0.02% 48 1215 0.03% 49 2534 0.06% 50 6743 0.17% 51 44524 1.11% 52 3941296 98.54% 3999512 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=60.32 fanout-score-rank=3 prefix-density=0.56 prefix-fanout=12.9 sequence=CTTCTTCTCCTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=6 fanout-score=138.95 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=17.7 sequence=CTTCTTCTTCTC Started job on | Feb 13 10:27:02 Started mapping on | Feb 13 10:27:17 Finished on | Feb 13 11:04:22 Mapping speed, Million of reads per hour | 6.47 Number of input reads | 3999512 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3496362 Uniquely mapped reads % | 87.42% Average mapped length | 51.83 Number of splices: Total | 437792 Number of splices: Annotated (sjdb) | 432550 Number of splices: GT/AG | 430637 Number of splices: GC/AG | 6358 Number of splices: AT/AC | 305 Number of splices: Non-canonical | 492 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314405 % of reads mapped to multiple loci | 7.86% Number of reads mapped to too many loci | 168519 % of reads mapped to too many loci | 4.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 188745 188745 188745 N_multimapping 314405 314405 314405 N_noFeature 128804 3461073 142881 N_ambiguous 35500 67 14241 UnstrandedReadsAssigned:3332058 PositiveStrandReadsAssigned:35222 NegativeStrandReadsAssigned:3339240 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423484 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423484-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,512 reads, 3,634,069 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,000 rounds 52401 SRR5423484.ke.tsv 34699 SRR5423484.se.tsv 87100 total ==> SRR5423484.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 48 7.38119 Potri.005G024800.1.v4.1 1035 936 3 0.945813 Potri.004G059700.1.v4.1 961 862 10 3.42336 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 47.5995 4.93893 Potri.016G087400.1.v4.1 270 171 164 283.014 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 183 61.5059 ==> SRR5423484.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 76 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423484 completed mapping pipeline successfully