Starting /dee2/code/volunteer_pipeline.sh SRR5423485 current disk space = 3093324488704 free memory = 1414003616 SRR5423485 SRAfilesize 01a706f2187333a9b38f7c27c9130648 SRR5423485.sra SRR5423485.sra file validated SRR5423485 is single end SRR5423485 is conventional basespace SRR5423485 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423485_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.66125 33.0 31.0 34.0 30.0 34.0 2 32.0065 33.0 31.0 34.0 30.0 34.0 3 32.144 34.0 31.0 34.0 30.0 34.0 4 33.02925 37.0 33.0 37.0 22.0 37.0 5 34.937 37.0 35.0 37.0 32.0 37.0 6 35.44475 37.0 35.0 37.0 33.0 37.0 7 35.59975 37.0 35.0 37.0 33.0 37.0 8 35.71125 37.0 35.0 37.0 33.0 37.0 9 37.471 39.0 37.0 39.0 34.0 39.0 10 37.31425 39.0 37.0 39.0 34.0 39.0 11 37.38025 39.0 37.0 39.0 34.0 39.0 12 37.32425 39.0 37.0 39.0 34.0 39.0 13 37.161 39.0 37.0 39.0 33.0 39.0 14 38.665 40.0 38.0 41.0 34.0 41.0 15 38.69525 40.0 38.0 41.0 34.0 41.0 16 38.6945 40.0 38.0 41.0 35.0 41.0 17 38.61975 40.0 38.0 41.0 34.0 41.0 18 38.7455 40.0 38.0 41.0 35.0 41.0 19 38.8205 40.0 38.0 41.0 35.0 41.0 20 38.61075 40.0 38.0 41.0 34.0 41.0 21 38.6775 40.0 38.0 41.0 34.0 41.0 22 38.487 40.0 38.0 41.0 34.0 41.0 23 38.5185 40.0 38.0 41.0 34.0 41.0 24 38.51875 40.0 38.0 41.0 34.0 41.0 25 38.614 40.0 38.0 41.0 34.0 41.0 26 38.53425 40.0 38.0 41.0 34.0 41.0 27 38.537 40.0 38.0 41.0 34.0 41.0 28 38.3945 40.0 38.0 41.0 34.0 41.0 29 38.42425 40.0 38.0 41.0 34.0 41.0 30 38.319 40.0 38.0 41.0 34.0 41.0 31 38.3755 40.0 38.0 41.0 34.0 41.0 32 38.4945 40.0 38.0 41.0 34.0 41.0 33 38.1885 40.0 38.0 41.0 33.0 41.0 34 38.2405 40.0 38.0 41.0 33.0 41.0 35 38.3105 40.0 38.0 41.0 34.0 41.0 36 38.026 40.0 38.0 41.0 33.0 41.0 37 38.0015 40.0 37.0 41.0 33.0 41.0 38 37.9305 40.0 37.0 41.0 33.0 41.0 39 38.0925 40.0 38.0 41.0 33.0 41.0 40 38.095 40.0 38.0 41.0 33.0 41.0 41 37.9215 40.0 37.0 41.0 33.0 41.0 42 37.89325 40.0 37.0 41.0 33.0 41.0 43 37.86175 40.0 37.0 41.0 33.0 41.0 44 37.82425 40.0 37.0 41.0 33.0 41.0 45 37.52875 40.0 37.0 41.0 32.0 41.0 46 37.6745 40.0 37.0 41.0 32.0 41.0 47 37.684 40.0 37.0 41.0 32.0 41.0 48 37.3705 40.0 36.0 41.0 31.0 41.0 49 37.589 40.0 36.0 41.0 32.0 41.0 50 37.36475 39.0 36.0 41.0 31.0 41.0 51 37.42175 39.0 36.0 41.0 31.0 41.0 52 36.56525 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2313 1 0.0 2313 2 0.0 2313 3 0.0 2313 4 0.0 2313 5 0.0 2313 6 0.0 2313 7 0.0 2313 8 0.0 2313 9 0.0 2313 10 0.0 2313 11 0.0 2313 12 0.0 2313 13 0.0 2313 14 0.0 2313 15 0.0 2313 16 0.0 2313 17 0.0 2313 18 0.0 2313 19 0.0 2313 20 0.0 2313 21 0.0 2313 22 0.0 2313 23 0.0 2313 24 0.0 2313 25 0.0 2313 26 0.0 2313 27 0.0 2313 28 0.0 2313 29 0.0 2313 30 0.0 2313 31 0.0 2313 32 0.0 2313 33 0.0 2313 34 0.0 2313 35 0.0 2313 36 0.0 2313 37 0.0 2313 38 0.0 2313 39 0.0 2313 40 0.0 2313 41 0.0 2313 42 0.0 2313 43 0.0 2313 44 0.0 2313 45 0.0 2313 46 0.0 2313 47 0.0 2313 48 0.0 2313 49 0.0 2313 50 0.0 2313 51 0.0 2313 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 3.0 23 0.0 24 5.0 25 7.0 26 14.0 27 17.0 28 30.0 29 30.0 30 60.0 31 104.0 32 87.0 33 127.0 34 182.0 35 234.0 36 296.0 37 444.0 38 780.0 39 1568.0 40 9.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.187046761690425 14.378594648662165 4.776194048512128 32.65816454113528 2 22.900000000000002 17.075000000000003 33.575 26.450000000000003 3 17.974999999999998 21.85 27.950000000000003 32.225 4 22.7 28.975 26.424999999999997 21.9 5 23.200000000000003 32.475 23.549999999999997 20.775 6 20.549999999999997 33.475 22.650000000000002 23.325000000000003 7 16.125 23.075000000000003 41.8 19.0 8 18.575 21.125 29.775000000000002 30.525000000000002 9 19.975 19.475 31.574999999999996 28.975 10 20.525 35.275 24.275 19.925 11 25.25 25.2 20.825 28.725 12 22.625 21.55 25.25 30.575000000000003 13 19.125 26.75 28.1 26.025 14 20.5 25.025 28.000000000000004 26.474999999999998 15 21.925 25.825 24.9 27.35 16 21.775 25.025 27.400000000000002 25.8 17 21.775 25.324999999999996 26.424999999999997 26.474999999999998 18 21.224999999999998 24.349999999999998 26.325 28.1 19 22.05 26.775 25.15 26.025 20 21.325 25.275 27.425 25.974999999999998 21 21.955488872218055 25.681420355088775 24.93123280820205 27.431857964491122 22 22.075 25.775 26.55 25.6 23 21.7 25.7 25.75 26.85 24 21.575 25.224999999999998 26.400000000000002 26.8 25 22.3 25.624999999999996 26.125 25.95 26 22.400000000000002 25.424999999999997 25.825 26.35 27 21.75 24.65 26.0 27.6 28 22.15 26.05 25.374999999999996 26.424999999999997 29 21.25 27.375 25.924999999999997 25.45 30 21.25 25.2 26.474999999999998 27.075 31 22.075 26.0 25.650000000000002 26.275 32 23.525 24.65 26.150000000000002 25.674999999999997 33 21.825 24.45 26.900000000000002 26.825 34 22.925 25.55 26.424999999999997 25.1 35 21.7 25.15 26.325 26.825 36 22.85 24.875 25.2 27.075 37 22.675 24.55 25.424999999999997 27.35 38 21.925 24.5 27.275 26.3 39 21.25 24.875 25.724999999999998 28.15 40 22.900000000000002 25.275 25.6 26.224999999999998 41 22.725 25.025 26.325 25.924999999999997 42 22.7 25.674999999999997 24.85 26.775 43 22.55 25.25 26.0 26.200000000000003 44 21.95 23.65 26.450000000000003 27.950000000000003 45 21.625 24.275 25.974999999999998 28.125 46 22.05551387846962 24.8062015503876 26.506626656664167 26.63165791447862 47 23.330832708177045 23.40585146286572 27.231807951987996 26.03150787696924 48 22.280570142535634 23.58089522380595 26.30657664416104 27.831957989497376 49 23.030757689422355 23.85596399099775 26.056514128532132 27.056764191047762 50 21.85546386596649 25.206301575393848 25.63140785196299 27.306826706676667 51 22.2 23.65 27.775 26.375 52 23.799999999999997 24.65 25.900000000000002 25.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 4.5 21 8.0 22 5.0 23 2.0 24 6.0 25 10.0 26 13.5 27 17.0 28 19.5 29 22.0 30 39.0 31 56.0 32 54.5 33 53.0 34 66.0 35 79.0 36 86.5 37 94.0 38 120.5 39 176.0 40 205.0 41 239.5 42 274.0 43 282.5 44 291.0 45 329.0 46 367.0 47 359.5 48 352.0 49 369.0 50 386.0 51 379.0 52 372.0 53 349.0 54 326.0 55 316.5 56 307.0 57 254.0 58 201.0 59 171.5 60 142.0 61 130.0 62 118.0 63 82.5 64 42.5 65 38.0 66 33.5 67 29.0 68 23.5 69 18.0 70 14.5 71 11.0 72 10.5 73 10.0 74 8.0 75 6.0 76 4.5 77 3.0 78 3.5 79 4.0 80 2.0 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.025 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.025 48 0.025 49 0.025 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75792141951838 97.39999999999999 2 1.0899873257287707 2.15 3 0.1520912547528517 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53137 spots for SRR5423485.sra Written 53137 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra Read 53136 spots for SRR5423485.sra Written 53136 spots for SRR5423485.sra SRR ids: ['SRR5423485.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sy1m785e SRR5423485.sra spots: 1062721 blocks: [[1, 53136], [53137, 106272], [106273, 159408], [159409, 212544], [212545, 265680], [265681, 318816], [318817, 371952], [371953, 425088], [425089, 478224], [478225, 531360], [531361, 584496], [584497, 637632], [637633, 690768], [690769, 743904], [743905, 797040], [797041, 850176], [850177, 903312], [903313, 956448], [956449, 1009584], [1009585, 1062721]] SRR5423485 file size 186246 SRR5423485 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423485 SRR5423485_1.fastq Input file: SRR5423485_1.fastq trimmed: SRR5423485-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 10:24:01 2025 >> started Thu Feb 13 10:28:26 2025 >> done (264.118s) 1062721 reads processed; of these: 63 ( 0.01%) short reads filtered out after trimming by size control 75 ( 0.01%) empty reads filtered out after trimming by size control 1062583 (99.99%) reads available; of these: 13100 ( 1.23%) trimmed reads available after processing 1049483 (98.77%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 5 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 2 0.00% 25 0 0.00% 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 1 0.00% 32 1 0.00% 33 6 0.00% 34 6 0.00% 35 3 0.00% 36 5 0.00% 37 5 0.00% 38 3 0.00% 39 6 0.00% 40 7 0.00% 41 12 0.00% 42 17 0.00% 43 16 0.00% 44 25 0.00% 45 36 0.00% 46 57 0.01% 47 102 0.01% 48 202 0.02% 49 408 0.04% 50 1483 0.14% 51 10689 1.01% 52 1049483 98.77% 1062583 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=24 prefix-density=0.15 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=7 fanout-score=125.05 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=16.6 sequence=CTTCTTCTTCTC Started job on | Feb 13 10:30:39 Started mapping on | Feb 13 10:30:42 Finished on | Feb 13 10:34:41 Mapping speed, Million of reads per hour | 16.01 Number of input reads | 1062583 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 929574 Uniquely mapped reads % | 87.48% Average mapped length | 51.83 Number of splices: Total | 116413 Number of splices: Annotated (sjdb) | 115015 Number of splices: GT/AG | 114452 Number of splices: GC/AG | 1732 Number of splices: AT/AC | 92 Number of splices: Non-canonical | 137 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 82568 % of reads mapped to multiple loci | 7.77% Number of reads mapped to too many loci | 45327 % of reads mapped to too many loci | 4.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 50441 50441 50441 N_multimapping 82568 82568 82568 N_noFeature 34525 920200 38183 N_ambiguous 9334 14 3605 UnstrandedReadsAssigned:885715 PositiveStrandReadsAssigned:9360 NegativeStrandReadsAssigned:887786 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423485 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423485-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 1,062,583 reads, 964,635 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 994 rounds 52401 SRR5423485.ke.tsv 34699 SRR5423485.se.tsv 87100 total ==> SRR5423485.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 8 4.62779 Potri.005G024800.1.v4.1 1035 936 1 1.18599 Potri.004G059700.1.v4.1 961 862 2 2.57562 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 5.26627 2.05557 Potri.016G087400.1.v4.1 270 171 58 376.522 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.663137 Potri.012G127500.1.v4.1 977 878 36 45.5163 ==> SRR5423485.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 26 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423485 completed mapping pipeline successfully