Starting /dee2/code/volunteer_pipeline.sh SRR5423486 current disk space = 3093267599360 free memory = 1560945808 SRR5423486 SRAfilesize 056776c418ee193b83a5a413c1ea1ad2 SRR5423486.sra SRR5423486.sra file validated SRR5423486 is single end SRR5423486 is conventional basespace SRR5423486 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423486_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7 34.0 31.0 34.0 30.0 34.0 2 31.80275 34.0 31.0 34.0 28.0 34.0 3 32.59975 34.0 31.0 34.0 30.0 34.0 4 36.18225 37.0 35.0 37.0 35.0 37.0 5 36.1745 37.0 37.0 37.0 35.0 37.0 6 36.227 37.0 37.0 37.0 35.0 37.0 7 36.2675 37.0 37.0 37.0 35.0 37.0 8 36.3005 37.0 37.0 37.0 35.0 37.0 9 38.15425 39.0 39.0 39.0 37.0 39.0 10 38.1 39.0 38.0 39.0 37.0 39.0 11 37.88 39.0 38.0 39.0 35.0 39.0 12 38.00575 39.0 38.0 39.0 35.0 39.0 13 37.99625 39.0 38.0 39.0 35.0 39.0 14 39.4555 41.0 39.0 41.0 36.0 41.0 15 39.4695 41.0 39.0 41.0 36.0 41.0 16 39.34225 41.0 39.0 41.0 36.0 41.0 17 39.36225 41.0 39.0 41.0 36.0 41.0 18 39.4395 41.0 39.0 41.0 36.0 41.0 19 39.50975 41.0 39.0 41.0 37.0 41.0 20 39.4645 41.0 39.0 41.0 36.0 41.0 21 39.36025 41.0 39.0 41.0 36.0 41.0 22 39.2905 41.0 39.0 41.0 36.0 41.0 23 39.19125 41.0 39.0 41.0 36.0 41.0 24 39.138 41.0 39.0 41.0 36.0 41.0 25 39.2395 41.0 39.0 41.0 36.0 41.0 26 39.10525 41.0 39.0 41.0 36.0 41.0 27 39.0565 40.0 39.0 41.0 36.0 41.0 28 39.02425 40.0 39.0 41.0 36.0 41.0 29 39.0595 40.0 39.0 41.0 36.0 41.0 30 39.043 40.0 39.0 41.0 36.0 41.0 31 38.99875 40.0 39.0 41.0 36.0 41.0 32 38.85275 40.0 39.0 41.0 35.0 41.0 33 38.76125 40.0 39.0 41.0 35.0 41.0 34 38.78425 40.0 39.0 41.0 35.0 41.0 35 38.67325 40.0 38.0 41.0 35.0 41.0 36 38.63425 40.0 38.0 41.0 35.0 41.0 37 38.47325 40.0 38.0 41.0 34.0 41.0 38 38.3525 40.0 38.0 41.0 34.0 41.0 39 38.29875 40.0 38.0 41.0 34.0 41.0 40 38.256 40.0 38.0 41.0 34.0 41.0 41 38.05025 40.0 38.0 41.0 33.0 41.0 42 37.924 40.0 38.0 41.0 33.0 41.0 43 37.76975 40.0 38.0 41.0 32.0 41.0 44 37.747 40.0 38.0 41.0 33.0 41.0 45 37.737 40.0 38.0 41.0 33.0 41.0 46 37.6525 40.0 38.0 41.0 32.0 41.0 47 37.65675 40.0 37.0 41.0 32.0 41.0 48 37.51125 40.0 37.0 41.0 32.0 41.0 49 37.42875 40.0 37.0 41.0 32.0 41.0 50 37.356 40.0 37.0 41.0 32.0 41.0 51 37.15825 40.0 37.0 41.0 31.0 41.0 52 35.33425 38.0 34.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 2.0 20 1.0 21 3.0 22 3.0 23 8.0 24 5.0 25 12.0 26 16.0 27 24.0 28 24.0 29 37.0 30 35.0 31 49.0 32 67.0 33 72.0 34 119.0 35 164.0 36 226.0 37 368.0 38 740.0 39 2008.0 40 16.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.52229983879634 13.594841483073616 5.185384202041913 32.697474476088125 2 22.35 13.875000000000002 35.425000000000004 28.349999999999998 3 18.175 22.025 26.900000000000002 32.9 4 24.8 28.025 22.75 24.425 5 22.725 33.35 23.25 20.674999999999997 6 19.775000000000002 31.275 25.05 23.9 7 16.825000000000003 21.075 41.325 20.775 8 19.3 20.05 30.4 30.25 9 18.725 19.425 32.15 29.7 10 19.85 35.699999999999996 22.85 21.6 11 24.45 25.8 19.85 29.9 12 22.825 20.9 25.55 30.725 13 21.95 26.375 26.55 25.124999999999996 14 21.9 25.724999999999998 26.75 25.624999999999996 15 23.375 23.799999999999997 25.474999999999998 27.35 16 23.599999999999998 25.15 24.775 26.474999999999998 17 22.025 24.75 27.125 26.1 18 22.025 24.224999999999998 26.5 27.250000000000004 19 21.475 25.575 25.6 27.35 20 21.9 25.775 26.1 26.224999999999998 21 23.175 24.2 26.424999999999997 26.200000000000003 22 23.175 24.5 25.3 27.025 23 23.35 24.6 24.925 27.125 24 21.05 24.9 25.900000000000002 28.15 25 22.400000000000002 24.55 25.15 27.900000000000002 26 22.825 24.099999999999998 27.425 25.650000000000002 27 22.625 23.974999999999998 26.525 26.875 28 22.675 24.175 25.825 27.325 29 21.95 24.725 26.6 26.724999999999998 30 20.5 25.1 27.675 26.724999999999998 31 23.875 23.525 25.275 27.325 32 22.425 24.075 27.325 26.174999999999997 33 21.825 23.9 26.674999999999997 27.6 34 22.825 24.45 26.724999999999998 26.0 35 23.325000000000003 23.65 26.25 26.775 36 22.650000000000002 23.9 25.45 28.000000000000004 37 23.225 26.1 23.75 26.924999999999997 38 22.975 23.775 25.924999999999997 27.325 39 22.55 24.625 24.625 28.199999999999996 40 24.2 25.8 24.2 25.8 41 23.425 25.674999999999997 24.75 26.150000000000002 42 23.95 23.5 26.625 25.924999999999997 43 23.65 23.025000000000002 26.125 27.200000000000003 44 22.7 25.974999999999998 25.275 26.05 45 23.35 24.425 24.25 27.975 46 23.7 24.5 25.05 26.75 47 23.7 23.125 26.924999999999997 26.25 48 23.200000000000003 23.625 25.924999999999997 27.250000000000004 49 24.75 23.95 24.725 26.575 50 22.95 24.224999999999998 25.974999999999998 26.85 51 21.9 24.099999999999998 26.05 27.950000000000003 52 23.799999999999997 23.825 25.3 27.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 0.0 18 1.5 19 3.0 20 2.0 21 1.0 22 3.5 23 6.0 24 7.0 25 8.0 26 10.0 27 12.0 28 14.0 29 16.0 30 23.0 31 30.0 32 38.5 33 47.0 34 56.5 35 66.0 36 84.0 37 102.0 38 123.5 39 160.5 40 176.0 41 196.5 42 217.0 43 255.5 44 294.0 45 311.0 46 328.0 47 338.5 48 349.0 49 384.5 50 420.0 51 397.0 52 374.0 53 377.0 54 380.0 55 330.5 56 281.0 57 264.0 58 247.0 59 207.5 60 168.0 61 136.5 62 105.0 63 84.0 64 59.5 65 56.0 66 43.0 67 30.0 68 26.5 69 23.0 70 19.0 71 15.0 72 13.0 73 11.0 74 12.0 75 13.0 76 8.0 77 3.0 78 5.0 79 7.0 80 4.0 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.950000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.95 #Duplication Level Percentage of deduplicated Percentage of total 1 96.89942678478374 92.975 2 2.371026576341845 4.55 3 0.5211047420531527 1.5 4 0.13027618551328818 0.5 5 0.05211047420531526 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02605523710265763 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCGTACCAGTTCTGAGTCGACTGTTCGACGCCCGGGGAAGGCCCCCGAAG 9 0.22499999999999998 No Hit GTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCG 5 0.125 No Hit CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra Read 200000 spots for SRR5423486.sra Written 200000 spots for SRR5423486.sra SRR ids: ['SRR5423486.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ay00ymbl SRR5423486.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423486 file size 704008 SRR5423486 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423486 SRR5423486_1.fastq Input file: SRR5423486_1.fastq trimmed: SRR5423486-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 10:44:23 2025 >> started Thu Feb 13 10:49:10 2025 >> done (287.826s) 4000000 reads processed; of these: 188 ( 0.00%) short reads filtered out after trimming by size control 216 ( 0.01%) empty reads filtered out after trimming by size control 3999596 (99.99%) reads available; of these: 71249 ( 1.78%) trimmed reads available after processing 3928347 (98.22%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 4 0.00% 20 4 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 6 0.00% 25 13 0.00% 26 16 0.00% 27 15 0.00% 28 40 0.00% 29 23 0.00% 30 33 0.00% 31 48 0.00% 32 93 0.00% 33 66 0.00% 34 57 0.00% 35 60 0.00% 36 91 0.00% 37 137 0.00% 38 137 0.00% 39 125 0.00% 40 197 0.00% 41 285 0.01% 42 234 0.01% 43 320 0.01% 44 360 0.01% 45 864 0.02% 46 1233 0.03% 47 1280 0.03% 48 1737 0.04% 49 3403 0.09% 50 8196 0.20% 51 52160 1.30% 52 3928347 98.22% 3999596 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=15 prefix-density=0.26 prefix-fanout=2.0 sequence=ATTTAGCCTTGCAAGGTGGTCCTTGCTGATTCACACGGGATTCCACGTGCCCCATGCTACTCGGGTCAGAGCGTAAGCTAGTGATGCTTTCGGCTACTGGACTCTCTCCATCTAGGGTGCAGCACTCCACCGCTTCGCCTAGCAGCACGACGCTTGTATTGCTCTCCCACAACCCCGTTTTCACGGTTTAGGCTGCTCCCATTTCGCTCGCCGCTACTACGGGAATCGCTTTTGCTTTCTTTTCCTCTGGTTACTAAGATGTTTCAGTTCGCCAGGTTGTCTCTTGCCTGCCCATGGATTCGGCAGCAGTTTGAAAGGTTAACCTATTCGGGAATCTCCGGATCTACGCTTATTTTCAACTCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=16.38 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.4 sequence=CGCCCCGGGTTTTGCAGCGACCGCCGCGCCCTCCTACTCATCGGGGCCTGGCGCTTGCCCCGACGGCCGGGTATAGGTCGCGCGCTTCAGCGCCATCCATTTTCGGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTTCGACTTCCATGACCACCGTCCTGCTGTCTTAATCGACCAACACCCTTTGTGGGTTCTAGGTTAGCGCGCAGTTGGGCACCGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACTTGGAGCTCTCGATTCCGTGG Started job on | Feb 13 10:54:10 Started mapping on | Feb 13 10:54:13 Finished on | Feb 13 11:05:39 Mapping speed, Million of reads per hour | 20.99 Number of input reads | 3999596 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3203715 Uniquely mapped reads % | 80.10% Average mapped length | 51.85 Number of splices: Total | 397417 Number of splices: Annotated (sjdb) | 393163 Number of splices: GT/AG | 391090 Number of splices: GC/AG | 5692 Number of splices: AT/AC | 235 Number of splices: Non-canonical | 400 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331433 % of reads mapped to multiple loci | 8.29% Number of reads mapped to too many loci | 440556 % of reads mapped to too many loci | 11.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 464448 464448 464448 N_multimapping 331433 331433 331433 N_noFeature 193609 3164885 205843 N_ambiguous 39504 31 12893 UnstrandedReadsAssigned:2970602 PositiveStrandReadsAssigned:38799 NegativeStrandReadsAssigned:2984979 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423486 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423486-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,596 reads, 3,467,462 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52401 SRR5423486.ke.tsv 34699 SRR5423486.se.tsv 87100 total ==> SRR5423486.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 42 7.31411 Potri.005G024800.1.v4.1 1035 936 4 1.42814 Potri.004G059700.1.v4.1 961 862 2 0.775372 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 37.174 4.36814 Potri.016G087400.1.v4.1 270 171 81 158.298 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.199633 Potri.012G127500.1.v4.1 977 878 122 46.4357 ==> SRR5423486.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 69 Potri.001G212900.v4.1 75 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423486 completed mapping pipeline successfully