Starting /dee2/code/volunteer_pipeline.sh SRR5423487 current disk space = 3093067649024 free memory = 1557281036 SRR5423487 SRAfilesize 29d2cc243a2060d377117399bb8e4762 SRR5423487.sra SRR5423487.sra file validated SRR5423487 is single end SRR5423487 is conventional basespace SRR5423487 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423487_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1075 33.0 31.0 34.0 30.0 34.0 2 32.1255 34.0 31.0 34.0 30.0 34.0 3 32.25175 34.0 31.0 34.0 30.0 34.0 4 35.57225 37.0 35.0 37.0 33.0 37.0 5 35.7355 37.0 35.0 37.0 33.0 37.0 6 35.69875 37.0 35.0 37.0 33.0 37.0 7 35.70625 37.0 35.0 37.0 33.0 37.0 8 35.788 37.0 35.0 37.0 35.0 37.0 9 37.48625 39.0 37.0 39.0 35.0 39.0 10 37.394 39.0 37.0 39.0 34.0 39.0 11 37.304 39.0 37.0 39.0 34.0 39.0 12 37.37 39.0 37.0 39.0 34.0 39.0 13 37.19625 39.0 37.0 39.0 33.0 39.0 14 38.69125 40.0 38.0 41.0 34.0 41.0 15 38.55225 40.0 38.0 41.0 34.0 41.0 16 38.5255 40.0 38.0 41.0 34.0 41.0 17 38.51875 40.0 38.0 41.0 34.0 41.0 18 38.24475 40.0 38.0 41.0 33.0 41.0 19 38.42025 40.0 38.0 41.0 34.0 41.0 20 38.5805 40.0 38.0 41.0 34.0 41.0 21 38.52775 40.0 38.0 41.0 34.0 41.0 22 38.47975 40.0 38.0 41.0 34.0 41.0 23 38.5935 40.0 38.0 41.0 34.0 41.0 24 38.6515 40.0 38.0 41.0 34.0 41.0 25 38.60225 40.0 38.0 41.0 34.0 41.0 26 38.64125 40.0 38.0 41.0 34.0 41.0 27 38.43625 40.0 38.0 41.0 34.0 41.0 28 38.58525 40.0 38.0 41.0 34.0 41.0 29 38.39825 40.0 38.0 41.0 34.0 41.0 30 38.3475 40.0 38.0 41.0 34.0 41.0 31 38.31125 40.0 38.0 41.0 34.0 41.0 32 38.25525 40.0 38.0 41.0 34.0 41.0 33 38.3885 40.0 38.0 41.0 34.0 41.0 34 38.27425 40.0 38.0 41.0 34.0 41.0 35 38.22275 40.0 38.0 41.0 33.0 41.0 36 38.13125 40.0 38.0 41.0 33.0 41.0 37 38.0695 40.0 37.0 41.0 33.0 41.0 38 37.9065 40.0 37.0 41.0 33.0 41.0 39 37.9625 40.0 37.0 41.0 33.0 41.0 40 37.8465 40.0 37.0 41.0 33.0 41.0 41 37.83775 40.0 37.0 41.0 33.0 41.0 42 37.8715 40.0 37.0 41.0 33.0 41.0 43 37.52625 40.0 37.0 41.0 32.0 41.0 44 37.45425 40.0 36.0 41.0 31.0 41.0 45 37.368 40.0 36.0 41.0 31.0 41.0 46 37.20875 39.0 36.0 41.0 31.0 41.0 47 37.26525 39.0 36.0 41.0 31.0 41.0 48 37.2615 39.0 36.0 41.0 31.0 41.0 49 37.2605 39.0 36.0 41.0 31.0 41.0 50 37.16575 39.0 36.0 41.0 31.0 41.0 51 37.2675 39.0 36.0 41.0 31.0 41.0 52 36.17825 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1112 1 0.0 1112 2 0.0 1112 3 0.0 1112 4 0.0 1112 5 0.0 1112 6 0.0 1112 7 0.0 1112 8 0.0 1112 9 0.0 1112 10 0.0 1112 11 0.0 1112 12 0.0 1112 13 0.0 1112 14 0.0 1112 15 0.0 1112 16 0.0 1112 17 0.0 1112 18 0.0 1112 19 0.0 1112 20 0.0 1112 21 0.0 1112 22 0.0 1112 23 0.0 1112 24 0.0 1112 25 0.0 1112 26 0.0 1112 27 0.0 1112 28 0.0 1112 29 0.0 1112 30 0.0 1112 31 0.0 1112 32 0.0 1112 33 0.0 1112 34 0.0 1112 35 0.0 1112 36 0.0 1112 37 0.0 1112 38 0.0 1112 39 0.0 1112 40 0.0 1112 41 0.0 1112 42 0.0 1112 43 0.0 1112 44 0.0 1112 45 0.0 1112 46 0.0 1112 47 0.0 1112 48 0.0 1112 49 0.0 1112 50 0.0 1112 51 0.0 1112 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 1.0 23 2.0 24 4.0 25 9.0 26 16.0 27 19.0 28 27.0 29 41.0 30 46.0 31 75.0 32 109.0 33 131.0 34 160.0 35 234.0 36 339.0 37 462.0 38 762.0 39 1548.0 40 13.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.82173259889835 13.845768652979471 4.581872809213821 33.750625938908364 2 22.900000000000002 16.925 34.175 26.0 3 20.95 21.025 25.95 32.074999999999996 4 24.625 29.4 22.6 23.375 5 22.825 32.75 23.05 21.375 6 20.7 32.074999999999996 23.1 24.125 7 16.125 20.0 42.65 21.224999999999998 8 18.65 20.8 30.85 29.7 9 19.7 19.575 30.975 29.75 10 20.349999999999998 35.725 23.425 20.5 11 25.15 24.575 20.25 30.025000000000002 12 24.025 20.775 25.8 29.4 13 20.875 24.9 27.800000000000004 26.424999999999997 14 22.5 25.025 26.075 26.400000000000002 15 22.5 23.9 26.775 26.825 16 22.6 24.875 25.974999999999998 26.55 17 23.25 25.025 25.25 26.474999999999998 18 22.25 25.5 25.624999999999996 26.625 19 23.599999999999998 25.1 25.424999999999997 25.874999999999996 20 23.325000000000003 25.4 26.075 25.2 21 22.85 23.95 26.775 26.424999999999997 22 23.95 24.825 25.1 26.125 23 23.3 23.525 26.85 26.325 24 21.525 23.150000000000002 26.450000000000003 28.875 25 21.325 25.15 25.575 27.950000000000003 26 21.925 24.6 26.174999999999997 27.3 27 22.225 23.775 25.85 28.15 28 22.725 25.474999999999998 24.349999999999998 27.450000000000003 29 21.975 25.025 26.224999999999998 26.775 30 22.05 25.575 25.75 26.625 31 22.7 25.1 26.125 26.075 32 22.400000000000002 23.9 27.025 26.674999999999997 33 21.65 24.775 25.825 27.750000000000004 34 22.2 25.674999999999997 25.775 26.35 35 21.2 23.875 27.375 27.55 36 21.475 24.5 25.224999999999998 28.799999999999997 37 22.975 24.425 24.675 27.925 38 21.224999999999998 23.925 26.450000000000003 28.4 39 22.85 23.525 25.35 28.275 40 23.025000000000002 25.15 25.2 26.625 41 22.900000000000002 23.974999999999998 25.8 27.325 42 22.275 25.25 25.1 27.375 43 22.625 24.175 26.1 27.1 44 23.075000000000003 24.2 26.650000000000002 26.075 45 22.8 24.349999999999998 26.275 26.575 46 23.400000000000002 25.624999999999996 24.875 26.1 47 23.125 23.75 26.200000000000003 26.924999999999997 48 21.7 23.625 25.575 29.099999999999998 49 22.375 24.95 25.1 27.575 50 22.3 25.2 25.900000000000002 26.6 51 21.575 24.2 26.275 27.950000000000003 52 23.1 24.474999999999998 25.174999999999997 27.250000000000004 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 3.0 24 6.5 25 10.0 26 9.5 27 9.0 28 13.0 29 17.0 30 21.5 31 26.0 32 36.0 33 46.0 34 55.0 35 64.0 36 85.0 37 106.0 38 115.0 39 155.5 40 187.0 41 202.5 42 218.0 43 256.5 44 295.0 45 311.5 46 328.0 47 355.5 48 383.0 49 384.0 50 385.0 51 406.5 52 428.0 53 396.0 54 364.0 55 328.5 56 293.0 57 257.5 58 222.0 59 188.5 60 155.0 61 138.5 62 122.0 63 94.5 64 52.5 65 38.0 66 37.0 67 36.0 68 31.0 69 26.0 70 21.5 71 17.0 72 16.0 73 15.0 74 10.0 75 5.0 76 3.0 77 1.0 78 3.5 79 6.0 80 3.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.45 #Duplication Level Percentage of deduplicated Percentage of total 1 96.8895800933126 93.45 2 2.669777086573354 5.1499999999999995 3 0.36288232244686364 1.05 4 0.05184033177812338 0.2 5 0.0 0.0 6 0.02592016588906169 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra Read 200000 spots for SRR5423487.sra Written 200000 spots for SRR5423487.sra SRR ids: ['SRR5423487.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zo50r2ct SRR5423487.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423487 file size 703981 SRR5423487 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423487 SRR5423487_1.fastq Input file: SRR5423487_1.fastq trimmed: SRR5423487-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 11:00:54 2025 >> started Thu Feb 13 11:03:53 2025 >> done (178.998s) 4000000 reads processed; of these: 243 ( 0.01%) short reads filtered out after trimming by size control 234 ( 0.01%) empty reads filtered out after trimming by size control 3999523 (99.99%) reads available; of these: 81967 ( 2.05%) trimmed reads available after processing 3917556 (97.95%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 9 0.00% 20 13 0.00% 21 0 0.00% 22 3 0.00% 23 4 0.00% 24 8 0.00% 25 20 0.00% 26 15 0.00% 27 23 0.00% 28 47 0.00% 29 57 0.00% 30 57 0.00% 31 71 0.00% 32 139 0.00% 33 104 0.00% 34 64 0.00% 35 67 0.00% 36 88 0.00% 37 142 0.00% 38 151 0.00% 39 139 0.00% 40 210 0.01% 41 332 0.01% 42 293 0.01% 43 427 0.01% 44 570 0.01% 45 798 0.02% 46 1117 0.03% 47 1424 0.04% 48 1999 0.05% 49 3947 0.10% 50 9501 0.24% 51 60109 1.50% 52 3917556 97.95% 3999523 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=24 prefix-density=0.23 prefix-fanout=2.0 sequence=TTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=26.97 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=1.0 sequence=TCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGCCGACCTTGACCCCTGTTATTTTGAGGTCATATCTAGTATTCAGAGTTTGCCTCGATTTGGTACCGCTCTCGCGGCCCGCACCGAAACAGTGCTTTACCCCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCTCTGGGTTCGAGTGGCATTTCACCCCTAACCACAACTCATCCGCTGATTCTTCAACATCAGTCGGTTCGGACCTCCACTTAGTTTCACC Started job on | Feb 13 11:05:47 Started mapping on | Feb 13 11:05:47 Finished on | Feb 13 11:05:53 Mapping speed, Million of reads per hour | 2399.71 Number of input reads | 3999523 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3205951 Uniquely mapped reads % | 80.16% Average mapped length | 51.84 Number of splices: Total | 398741 Number of splices: Annotated (sjdb) | 394361 Number of splices: GT/AG | 392502 Number of splices: GC/AG | 5649 Number of splices: AT/AC | 207 Number of splices: Non-canonical | 383 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331097 % of reads mapped to multiple loci | 8.28% Number of reads mapped to too many loci | 437512 % of reads mapped to too many loci | 10.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.62% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 462475 462475 462475 N_multimapping 331097 331097 331097 N_noFeature 193462 3166839 205726 N_ambiguous 40114 27 13248 UnstrandedReadsAssigned:2972375 PositiveStrandReadsAssigned:39085 NegativeStrandReadsAssigned:2986977 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423487 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423487-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,523 reads, 3,465,182 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR5423487.ke.tsv 34699 SRR5423487.se.tsv 87100 total ==> SRR5423487.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 62 10.7788 Potri.005G024800.1.v4.1 1035 936 2 0.712867 Potri.004G059700.1.v4.1 961 862 4 1.54813 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 36.6994 4.3051 Potri.016G087400.1.v4.1 270 171 90 175.591 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.199296 Potri.012G127500.1.v4.1 977 878 91 34.5781 ==> SRR5423487.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 73 Potri.001G212900.v4.1 80 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423487 completed mapping pipeline successfully