Starting /dee2/code/volunteer_pipeline.sh SRR5423490 current disk space = 3092466601984 free memory = 1582803608 SRR5423490 SRAfilesize f3038fba982bd146ba85ae6965d4cdfb SRR5423490.sra SRR5423490.sra file validated SRR5423490 is single end SRR5423490 is conventional basespace SRR5423490 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423490_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6605 31.0 31.0 34.0 30.0 34.0 2 31.85125 33.0 31.0 34.0 30.0 34.0 3 31.88275 33.0 31.0 34.0 30.0 34.0 4 33.70625 35.0 33.0 37.0 27.0 37.0 5 35.069 37.0 35.0 37.0 32.0 37.0 6 35.381 37.0 35.0 37.0 33.0 37.0 7 35.558 37.0 35.0 37.0 33.0 37.0 8 35.6775 37.0 35.0 37.0 33.0 37.0 9 37.32275 39.0 37.0 39.0 34.0 39.0 10 37.19775 39.0 37.0 39.0 33.0 39.0 11 37.379 39.0 37.0 39.0 34.0 39.0 12 37.30975 39.0 37.0 39.0 34.0 39.0 13 37.15675 39.0 37.0 39.0 33.0 39.0 14 38.41975 40.0 38.0 41.0 34.0 41.0 15 38.47025 40.0 38.0 41.0 34.0 41.0 16 38.496 40.0 38.0 41.0 34.0 41.0 17 38.36875 40.0 38.0 41.0 33.0 41.0 18 38.298 40.0 38.0 41.0 33.0 41.0 19 38.11525 40.0 37.0 41.0 33.0 41.0 20 38.326 40.0 38.0 41.0 34.0 41.0 21 38.4185 40.0 38.0 41.0 34.0 41.0 22 38.45625 40.0 38.0 41.0 34.0 41.0 23 38.40775 40.0 38.0 41.0 34.0 41.0 24 38.369 40.0 38.0 41.0 34.0 41.0 25 38.34825 40.0 38.0 41.0 34.0 41.0 26 38.254 40.0 38.0 41.0 34.0 41.0 27 38.42075 40.0 38.0 41.0 34.0 41.0 28 38.3615 40.0 38.0 41.0 34.0 41.0 29 38.2855 40.0 38.0 41.0 34.0 41.0 30 38.3185 40.0 38.0 41.0 34.0 41.0 31 38.20775 40.0 38.0 41.0 33.0 41.0 32 38.13575 40.0 38.0 41.0 33.0 41.0 33 38.29625 40.0 38.0 41.0 34.0 41.0 34 38.18075 40.0 38.0 41.0 33.0 41.0 35 37.81825 40.0 37.0 41.0 33.0 41.0 36 37.915 40.0 37.0 41.0 33.0 41.0 37 37.89525 40.0 37.0 41.0 33.0 41.0 38 38.00375 40.0 37.0 41.0 33.0 41.0 39 37.886 40.0 37.0 41.0 33.0 41.0 40 37.87775 40.0 37.0 41.0 33.0 41.0 41 37.71825 40.0 37.0 41.0 32.0 41.0 42 37.57175 40.0 37.0 41.0 32.0 41.0 43 37.387 39.0 36.0 41.0 32.0 41.0 44 37.5375 40.0 37.0 41.0 32.0 41.0 45 37.49025 40.0 36.0 41.0 32.0 41.0 46 37.394 39.0 36.0 41.0 32.0 41.0 47 37.4805 39.0 37.0 41.0 32.0 41.0 48 37.3265 39.0 36.0 41.0 31.0 41.0 49 37.2505 39.0 36.0 41.0 31.0 41.0 50 37.40475 39.0 36.0 41.0 32.0 41.0 51 37.20675 39.0 36.0 41.0 31.0 41.0 52 36.372 38.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1313 1 0.0 1313 2 0.0 1313 3 0.0 1313 4 0.0 1313 5 0.0 1313 6 0.0 1313 7 0.0 1313 8 0.0 1313 9 0.0 1313 10 0.0 1313 11 0.0 1313 12 0.0 1313 13 0.0 1313 14 0.0 1313 15 0.0 1313 16 0.0 1313 17 0.0 1313 18 0.0 1313 19 0.0 1313 20 0.0 1313 21 0.0 1313 22 0.0 1313 23 0.0 1313 24 0.0 1313 25 0.0 1313 26 0.0 1313 27 0.0 1313 28 0.0 1313 29 0.0 1313 30 0.0 1313 31 0.0 1313 32 0.0 1313 33 0.0 1313 34 0.0 1313 35 0.0 1313 36 0.0 1313 37 0.0 1313 38 0.0 1313 39 0.0 1313 40 0.0 1313 41 0.0 1313 42 0.0 1313 43 0.0 1313 44 0.0 1313 45 0.0 1313 46 0.0 1313 47 0.0 1313 48 0.0 1313 49 0.0 1313 50 0.0 1313 51 0.0 1313 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 1.0 22 1.0 23 3.0 24 4.0 25 6.0 26 20.0 27 28.0 28 27.0 29 38.0 30 50.0 31 86.0 32 102.0 33 141.0 34 198.0 35 245.0 36 378.0 37 467.0 38 754.0 39 1443.0 40 6.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.78362133734034 14.024542950162786 4.9336338592536935 33.25820185324317 2 22.25 15.9 34.925 26.924999999999997 3 19.950000000000003 21.175 27.900000000000002 30.975 4 24.8 29.299999999999997 22.900000000000002 23.0 5 24.25 33.550000000000004 21.95 20.25 6 19.2 32.800000000000004 23.3 24.7 7 15.825 21.825 41.449999999999996 20.9 8 18.75 20.7 31.225 29.325000000000003 9 18.925 20.125 32.2 28.749999999999996 10 20.599999999999998 35.725 21.85 21.825 11 25.324999999999996 24.325 20.549999999999997 29.799999999999997 12 21.875 22.6 25.624999999999996 29.9 13 21.825 24.65 27.825 25.7 14 21.75 24.925 26.275 27.05 15 21.8 25.15 26.900000000000002 26.150000000000002 16 22.575 24.925 25.4 27.1 17 22.625 26.8 24.099999999999998 26.474999999999998 18 21.6 25.074999999999996 25.174999999999997 28.15 19 22.425 25.15 26.150000000000002 26.275 20 22.375 25.074999999999996 26.400000000000002 26.150000000000002 21 22.5 25.474999999999998 26.275 25.75 22 23.075000000000003 25.55 24.8 26.575 23 22.7 25.35 24.25 27.700000000000003 24 23.025000000000002 24.349999999999998 24.575 28.050000000000004 25 23.150000000000002 25.474999999999998 25.424999999999997 25.95 26 21.825 24.075 27.425 26.674999999999997 27 21.75 24.0 26.150000000000002 28.1 28 23.125 24.2 25.95 26.724999999999998 29 21.625 25.15 25.424999999999997 27.800000000000004 30 21.9 25.825 26.924999999999997 25.35 31 23.400000000000002 24.5 25.75 26.35 32 21.85 25.650000000000002 24.775 27.725 33 22.5 25.1 26.125 26.275 34 23.425 24.275 24.775 27.525 35 20.825 25.6 25.775 27.800000000000004 36 21.975 24.6 26.875 26.55 37 21.75 25.974999999999998 25.5 26.775 38 22.325 24.4 25.75 27.525 39 22.6 24.025 26.025 27.35 40 22.725 24.474999999999998 25.3 27.500000000000004 41 22.075 25.674999999999997 24.425 27.825 42 22.175 24.9 26.6 26.325 43 22.525000000000002 25.025 25.724999999999998 26.724999999999998 44 22.975 23.674999999999997 25.124999999999996 28.225 45 21.75 24.2 26.724999999999998 27.325 46 22.650000000000002 25.0 24.85 27.500000000000004 47 22.05 24.55 24.925 28.475 48 22.225 24.325 26.275 27.175 49 24.525 23.724999999999998 24.575 27.175 50 23.025000000000002 25.074999999999996 24.85 27.05 51 21.224999999999998 24.275 27.325 27.175 52 23.45 22.75 25.525 28.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 1.5 21 1.0 22 1.5 23 2.0 24 4.0 25 6.0 26 7.0 27 8.0 28 16.0 29 24.0 30 28.5 31 33.0 32 40.5 33 48.0 34 63.0 35 78.0 36 102.0 37 126.0 38 123.0 39 152.0 40 184.0 41 207.0 42 230.0 43 267.0 44 304.0 45 299.0 46 294.0 47 330.5 48 367.0 49 377.0 50 387.0 51 378.0 52 369.0 53 372.0 54 375.0 55 352.5 56 330.0 57 286.5 58 243.0 59 196.5 60 150.0 61 137.0 62 124.0 63 93.5 64 55.0 65 47.0 66 37.5 67 28.0 68 21.5 69 15.0 70 13.0 71 11.0 72 14.0 73 17.0 74 12.5 75 8.0 76 4.0 77 0.0 78 2.0 79 4.0 80 2.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.075 #Duplication Level Percentage of deduplicated Percentage of total 1 96.82539682539682 93.025 2 2.602133749674733 5.0 3 0.312256049960968 0.8999999999999999 4 0.18214936247723132 0.7000000000000001 5 0.078064012490242 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAGAAATCACATTGCGTGAGCATCCGCAGGGACCATCGCAATGCTTTGTTT 5 0.125 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 5 0.125 No Hit GATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra Read 200000 spots for SRR5423490.sra Written 200000 spots for SRR5423490.sra SRR ids: ['SRR5423490.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7a1_7pcj SRR5423490.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423490 file size 703999 SRR5423490 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423490 SRR5423490_1.fastq Input file: SRR5423490_1.fastq trimmed: SRR5423490-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:15:58 2025 >> started Thu Feb 13 12:16:00 2025 >> done (2.194s) 4000000 reads processed; of these: 215 ( 0.01%) short reads filtered out after trimming by size control 215 ( 0.01%) empty reads filtered out after trimming by size control 3999570 (99.99%) reads available; of these: 68424 ( 1.71%) trimmed reads available after processing 3931146 (98.29%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 15 0.00% 20 11 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 10 0.00% 25 12 0.00% 26 16 0.00% 27 13 0.00% 28 21 0.00% 29 26 0.00% 30 36 0.00% 31 56 0.00% 32 72 0.00% 33 63 0.00% 34 61 0.00% 35 60 0.00% 36 80 0.00% 37 127 0.00% 38 116 0.00% 39 133 0.00% 40 213 0.01% 41 261 0.01% 42 224 0.01% 43 345 0.01% 44 447 0.01% 45 812 0.02% 46 1140 0.03% 47 1287 0.03% 48 1663 0.04% 49 3268 0.08% 50 8096 0.20% 51 49726 1.24% 52 3931146 98.29% 3999570 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=29 prefix-density=0.25 prefix-fanout=1.9 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=11.35 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=2.3 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCT Started job on | Feb 13 12:16:11 Started mapping on | Feb 13 12:16:11 Finished on | Feb 13 12:16:16 Mapping speed, Million of reads per hour | 2879.69 Number of input reads | 3999570 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3204818 Uniquely mapped reads % | 80.13% Average mapped length | 51.85 Number of splices: Total | 398124 Number of splices: Annotated (sjdb) | 393729 Number of splices: GT/AG | 391892 Number of splices: GC/AG | 5626 Number of splices: AT/AC | 219 Number of splices: Non-canonical | 387 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330099 % of reads mapped to multiple loci | 8.25% Number of reads mapped to too many loci | 440267 % of reads mapped to too many loci | 11.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 464653 464653 464653 N_multimapping 330099 330099 330099 N_noFeature 194433 3166148 206522 N_ambiguous 39693 32 13091 UnstrandedReadsAssigned:2970692 PositiveStrandReadsAssigned:38638 NegativeStrandReadsAssigned:2985205 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423490 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423490-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,570 reads, 3,465,185 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52401 SRR5423490.ke.tsv 34699 SRR5423490.se.tsv 87100 total ==> SRR5423490.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 57 9.91975 Potri.005G024800.1.v4.1 1035 936 5 1.784 Potri.004G059700.1.v4.1 961 862 4 1.54972 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 42.6974 5.01386 Potri.016G087400.1.v4.1 270 171 81 158.194 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.199501 Potri.012G127500.1.v4.1 977 878 146 55.534 ==> SRR5423490.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 45 Potri.001G212900.v4.1 62 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423490 completed mapping pipeline successfully