Starting /dee2/code/volunteer_pipeline.sh SRR5423491 current disk space = 3092471369728 free memory = 1582799580 SRR5423491 SRAfilesize 7ef4acbcf1c0cb693afd5ecf50c513f4 SRR5423491.sra SRR5423491.sra file validated SRR5423491 is single end SRR5423491 is conventional basespace SRR5423491 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423491_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.566 34.0 31.0 34.0 31.0 34.0 2 32.60125 34.0 31.0 34.0 31.0 34.0 3 32.6995 34.0 31.0 34.0 31.0 34.0 4 36.08925 37.0 35.0 37.0 35.0 37.0 5 36.13 37.0 35.0 37.0 35.0 37.0 6 36.037 37.0 35.0 37.0 35.0 37.0 7 36.10025 37.0 35.0 37.0 35.0 37.0 8 36.12375 37.0 35.0 37.0 35.0 37.0 9 37.72075 39.0 38.0 39.0 35.0 39.0 10 37.5925 39.0 37.0 39.0 35.0 39.0 11 37.60275 39.0 37.0 39.0 35.0 39.0 12 37.712 39.0 38.0 39.0 35.0 39.0 13 37.6955 39.0 37.0 39.0 35.0 39.0 14 39.12175 40.0 39.0 41.0 36.0 41.0 15 39.06425 40.0 39.0 41.0 36.0 41.0 16 39.0215 40.0 38.0 41.0 36.0 41.0 17 39.043 40.0 38.0 41.0 36.0 41.0 18 38.975 40.0 38.0 41.0 36.0 41.0 19 39.1445 40.0 39.0 41.0 36.0 41.0 20 39.08925 40.0 39.0 41.0 36.0 41.0 21 39.0515 40.0 39.0 41.0 35.0 41.0 22 39.05225 40.0 39.0 41.0 35.0 41.0 23 38.9695 40.0 38.0 41.0 35.0 41.0 24 38.94925 40.0 39.0 41.0 35.0 41.0 25 38.97625 40.0 38.0 41.0 35.0 41.0 26 38.887 40.0 38.0 41.0 35.0 41.0 27 38.86625 40.0 39.0 41.0 35.0 41.0 28 38.753 40.0 38.0 41.0 34.0 41.0 29 38.756 40.0 38.0 41.0 35.0 41.0 30 38.76575 40.0 38.0 41.0 35.0 41.0 31 38.77075 40.0 38.0 41.0 35.0 41.0 32 38.7055 40.0 38.0 41.0 35.0 41.0 33 38.515 40.0 38.0 41.0 34.0 41.0 34 38.60225 40.0 38.0 41.0 34.0 41.0 35 38.6215 40.0 38.0 41.0 35.0 41.0 36 38.56725 40.0 38.0 41.0 34.0 41.0 37 38.475 40.0 38.0 41.0 34.0 41.0 38 38.37975 40.0 38.0 41.0 34.0 41.0 39 38.3865 40.0 38.0 41.0 34.0 41.0 40 38.194 40.0 38.0 41.0 33.0 41.0 41 38.113 40.0 38.0 41.0 33.0 41.0 42 38.12925 40.0 38.0 41.0 33.0 41.0 43 38.1655 40.0 38.0 41.0 33.0 41.0 44 38.18325 40.0 38.0 41.0 33.0 41.0 45 37.98725 40.0 37.0 41.0 33.0 41.0 46 38.03025 40.0 37.0 41.0 33.0 41.0 47 37.909 40.0 37.0 41.0 33.0 41.0 48 37.88425 40.0 37.0 41.0 33.0 41.0 49 37.89075 40.0 37.0 41.0 33.0 41.0 50 37.833 40.0 37.0 41.0 33.0 41.0 51 37.7155 40.0 37.0 41.0 33.0 41.0 52 36.69875 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2108 1 0.0 2108 2 0.0 2108 3 0.0 2108 4 0.0 2108 5 0.0 2108 6 0.0 2108 7 0.0 2108 8 0.0 2108 9 0.0 2108 10 0.0 2108 11 0.0 2108 12 0.0 2108 13 0.0 2108 14 0.0 2108 15 0.0 2108 16 0.0 2108 17 0.0 2108 18 0.0 2108 19 0.0 2108 20 0.0 2108 21 0.0 2108 22 0.0 2108 23 0.0 2108 24 0.0 2108 25 0.0 2108 26 0.0 2108 27 0.0 2108 28 0.0 2108 29 0.0 2108 30 0.0 2108 31 0.0 2108 32 0.0 2108 33 0.0 2108 34 0.0 2108 35 0.0 2108 36 0.0 2108 37 0.0 2108 38 0.0 2108 39 0.0 2108 40 0.0 2108 41 0.0 2108 42 0.0 2108 43 0.0 2108 44 0.0 2108 45 0.0 2108 46 0.0 2108 47 0.0 2108 48 0.0 2108 49 0.0 2108 50 0.0 2108 51 0.0 2108 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 10.0 25 6.0 26 12.0 27 18.0 28 21.0 29 28.0 30 45.0 31 55.0 32 76.0 33 89.0 34 139.0 35 164.0 36 249.0 37 375.0 38 776.0 39 1919.0 40 14.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.55997996493864 13.348359629351364 4.783370899073378 33.30828950663661 2 22.325 14.625 34.975 28.075 3 18.375 21.2 27.500000000000004 32.925 4 24.775 28.825 23.35 23.05 5 22.525000000000002 33.800000000000004 22.95 20.724999999999998 6 21.15 31.825 22.625 24.4 7 16.475 20.7 42.25 20.575 8 19.225 19.85 30.049999999999997 30.875000000000004 9 19.3 19.6 31.924999999999997 29.175 10 21.075 34.475 23.825 20.625 11 24.15 24.224999999999998 20.875 30.75 12 22.5 21.15 25.15 31.2 13 21.475 26.5 26.825 25.2 14 21.625 23.599999999999998 28.525 26.25 15 21.15 23.724999999999998 26.924999999999997 28.199999999999996 16 23.325000000000003 24.775 25.45 26.450000000000003 17 22.875 23.625 26.875 26.625 18 22.8 23.599999999999998 26.3 27.3 19 22.85 25.424999999999997 24.675 27.05 20 21.25 25.624999999999996 27.525 25.6 21 21.725 24.474999999999998 27.275 26.525 22 21.75 25.85 25.85 26.55 23 23.125 24.975 25.624999999999996 26.275 24 22.0 24.275 25.924999999999997 27.800000000000004 25 22.475 25.4 25.75 26.375 26 22.35 26.55 25.724999999999998 25.374999999999996 27 21.825 25.624999999999996 25.3 27.250000000000004 28 22.5 24.7 26.75 26.05 29 21.25 25.674999999999997 27.05 26.025 30 21.975 23.95 26.325 27.750000000000004 31 22.175 25.275 25.724999999999998 26.825 32 22.7 25.025 25.275 27.0 33 22.325 24.65 25.7 27.325 34 22.375 25.275 26.075 26.275 35 21.95 25.025 26.55 26.474999999999998 36 22.225 24.0 25.275 28.499999999999996 37 22.95 25.7 23.575 27.775 38 23.625 25.324999999999996 25.1 25.95 39 21.825 25.2 24.825 28.15 40 22.400000000000002 25.874999999999996 25.5 26.224999999999998 41 22.1 25.650000000000002 25.7 26.55 42 21.675 25.7 26.0 26.625 43 22.975 23.425 26.224999999999998 27.375 44 21.45 24.825 26.674999999999997 27.05 45 22.2 24.275 26.875 26.650000000000002 46 23.225 24.15 26.075 26.55 47 22.95 24.925 25.900000000000002 26.224999999999998 48 22.080520130032507 25.056264066016503 24.681170292573142 28.182045511377847 49 22.175 25.275 25.25 27.3 50 22.5 24.625 27.200000000000003 25.674999999999997 51 23.0 22.775000000000002 25.424999999999997 28.799999999999997 52 22.8 24.175 25.35 27.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 1.0 17 1.0 18 0.5 19 0.0 20 1.5 21 3.0 22 4.0 23 5.0 24 8.0 25 11.0 26 10.0 27 9.0 28 13.5 29 18.0 30 28.5 31 39.0 32 44.0 33 49.0 34 62.5 35 76.0 36 95.5 37 115.0 38 118.0 39 154.0 40 187.0 41 201.5 42 216.0 43 242.5 44 269.0 45 312.5 46 356.0 47 352.5 48 349.0 49 388.5 50 428.0 51 413.5 52 399.0 53 370.5 54 342.0 55 329.0 56 316.0 57 273.0 58 230.0 59 188.0 60 146.0 61 127.5 62 109.0 63 89.5 64 56.5 65 43.0 66 33.5 67 24.0 68 24.0 69 24.0 70 23.0 71 22.0 72 18.5 73 15.0 74 10.0 75 5.0 76 2.5 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.88155136268344 92.425 2 2.2274633123689727 4.25 3 0.4716981132075472 1.35 4 0.20964360587002098 0.8 5 0.10482180293501049 0.5 6 0.052410901467505246 0.3 7 0.026205450733752623 0.17500000000000002 8 0.026205450733752623 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAA 8 0.2 No Hit GTTGAATACATCAGTGTAGCGCGCGTGCGGCCCAGAACATCTAAGGGCATCA 7 0.17500000000000002 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 6 0.15 No Hit CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTA 6 0.15 No Hit GTCGGTTTCGGGTACAGGTACCCTTTTGTTGAAGGTCGTTCGAGCTTTTCCT 5 0.125 No Hit GCCTCCTCAAGCTCAAGCAACACTTGAGATGCCTCAGTGCATCCAAACATGG 5 0.125 No Hit CCAGAACCCAAAAACTTTGATTTCTCATAAGGTGCTGGCGGAGTCCTAAAAG 5 0.125 No Hit CTTGTCCGTACCAGTTCTGAGTCGACTGTTCGACGCCCGGGGAAGGCCCCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra Read 200000 spots for SRR5423491.sra Written 200000 spots for SRR5423491.sra SRR ids: ['SRR5423491.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9igxgeia SRR5423491.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423491 file size 703993 SRR5423491 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423491 SRR5423491_1.fastq Input file: SRR5423491_1.fastq trimmed: SRR5423491-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:15:41 2025 >> started Thu Feb 13 12:15:43 2025 >> done (2.694s) 4000000 reads processed; of these: 258 ( 0.01%) short reads filtered out after trimming by size control 203 ( 0.01%) empty reads filtered out after trimming by size control 3999539 (99.99%) reads available; of these: 70291 ( 1.76%) trimmed reads available after processing 3929248 (98.24%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 6 0.00% 20 7 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 15 0.00% 26 16 0.00% 27 31 0.00% 28 34 0.00% 29 43 0.00% 30 36 0.00% 31 71 0.00% 32 95 0.00% 33 69 0.00% 34 53 0.00% 35 62 0.00% 36 76 0.00% 37 98 0.00% 38 100 0.00% 39 136 0.00% 40 138 0.00% 41 194 0.00% 42 241 0.01% 43 316 0.01% 44 416 0.01% 45 598 0.01% 46 905 0.02% 47 1104 0.03% 48 1687 0.04% 49 3552 0.09% 50 8429 0.21% 51 51740 1.29% 52 3929248 98.24% 3999539 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.24 prefix-fanout=2.0 sequence=TTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=25.29 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=1.0 sequence=CCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGCCGACCTTGACCCCTGTTATTTTGAGGTCATATCTAGTATTCAGAGTTTGCCTCGATTTGGTACCGCTCTCGCGGCCCGCACCGAAACAGTGCTTTACCCCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCTCTGGGTTCGAGTGGCATTTCACCCCTAACCACAACTCATCCGCTGATTCTTCAACATCAGTCGGTTCGGACCTCCACTTAGTTTCACCC Started job on | Feb 13 12:15:57 Started mapping on | Feb 13 12:15:57 Finished on | Feb 13 12:16:03 Mapping speed, Million of reads per hour | 2399.72 Number of input reads | 3999539 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3204895 Uniquely mapped reads % | 80.13% Average mapped length | 51.84 Number of splices: Total | 397912 Number of splices: Annotated (sjdb) | 393651 Number of splices: GT/AG | 391687 Number of splices: GC/AG | 5609 Number of splices: AT/AC | 215 Number of splices: Non-canonical | 401 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 1.61 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 329388 % of reads mapped to multiple loci | 8.24% Number of reads mapped to too many loci | 440779 % of reads mapped to too many loci | 11.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.61% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 465256 465256 465256 N_multimapping 329388 329388 329388 N_noFeature 194161 3166177 206254 N_ambiguous 39803 38 13159 UnstrandedReadsAssigned:2970931 PositiveStrandReadsAssigned:38680 NegativeStrandReadsAssigned:2985482 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423491 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423491-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,539 reads, 3,453,247 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR5423491.ke.tsv 34699 SRR5423491.se.tsv 87100 total ==> SRR5423491.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 53 9.26781 Potri.005G024800.1.v4.1 1035 936 3 1.07553 Potri.004G059700.1.v4.1 961 862 5 1.94643 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 43.1799 5.09482 Potri.016G087400.1.v4.1 270 171 80 156.989 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.200457 Potri.012G127500.1.v4.1 977 878 96 36.6904 ==> SRR5423491.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 60 Potri.001G212900.v4.1 78 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423491 completed mapping pipeline successfully