Starting /dee2/code/volunteer_pipeline.sh SRR5423492 current disk space = 3093259968512 free memory = 1412057368 SRR5423492 SRAfilesize 4b58b121103412af666e4982e733bd4d SRR5423492.sra SRR5423492.sra file validated SRR5423492 is single end SRR5423492 is conventional basespace SRR5423492 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423492_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.853 34.0 31.0 34.0 31.0 34.0 2 33.00675 34.0 33.0 34.0 31.0 34.0 3 33.007 34.0 33.0 34.0 31.0 34.0 4 36.38975 37.0 37.0 37.0 35.0 37.0 5 36.39575 37.0 37.0 37.0 35.0 37.0 6 36.422 37.0 37.0 37.0 35.0 37.0 7 36.34925 37.0 37.0 37.0 35.0 37.0 8 36.37925 37.0 37.0 37.0 35.0 37.0 9 38.151 39.0 39.0 39.0 37.0 39.0 10 38.16 39.0 39.0 39.0 37.0 39.0 11 38.16425 39.0 39.0 39.0 37.0 39.0 12 38.21675 39.0 39.0 39.0 37.0 39.0 13 38.17075 39.0 39.0 39.0 37.0 39.0 14 39.736 41.0 40.0 41.0 38.0 41.0 15 39.60625 41.0 40.0 41.0 37.0 41.0 16 39.6715 41.0 40.0 41.0 37.0 41.0 17 39.6665 41.0 40.0 41.0 37.0 41.0 18 39.59875 41.0 40.0 41.0 37.0 41.0 19 39.64 41.0 40.0 41.0 37.0 41.0 20 39.62675 41.0 40.0 41.0 37.0 41.0 21 39.55575 41.0 40.0 41.0 37.0 41.0 22 39.66725 41.0 40.0 41.0 37.0 41.0 23 39.6205 41.0 40.0 41.0 37.0 41.0 24 39.57675 41.0 40.0 41.0 37.0 41.0 25 39.50475 41.0 39.0 41.0 37.0 41.0 26 39.42025 41.0 40.0 41.0 37.0 41.0 27 39.34675 41.0 39.0 41.0 37.0 41.0 28 39.4385 41.0 40.0 41.0 37.0 41.0 29 39.3745 41.0 39.0 41.0 37.0 41.0 30 39.23525 41.0 39.0 41.0 36.0 41.0 31 39.2655 41.0 40.0 41.0 36.0 41.0 32 39.271 41.0 39.0 41.0 36.0 41.0 33 39.17775 41.0 39.0 41.0 36.0 41.0 34 39.1775 41.0 39.0 41.0 36.0 41.0 35 39.15025 41.0 39.0 41.0 36.0 41.0 36 39.05125 41.0 39.0 41.0 36.0 41.0 37 39.0215 40.0 39.0 41.0 35.0 41.0 38 38.88475 40.0 39.0 41.0 35.0 41.0 39 38.74225 40.0 38.0 41.0 35.0 41.0 40 38.74825 40.0 39.0 41.0 35.0 41.0 41 38.56175 40.0 38.0 41.0 34.0 41.0 42 38.53925 40.0 38.0 41.0 35.0 41.0 43 38.52825 40.0 38.0 41.0 35.0 41.0 44 38.43675 40.0 38.0 41.0 34.0 41.0 45 38.315 40.0 38.0 41.0 34.0 41.0 46 38.252 40.0 38.0 41.0 34.0 41.0 47 38.00675 40.0 38.0 41.0 33.0 41.0 48 38.099 40.0 38.0 41.0 33.0 41.0 49 38.00425 40.0 37.0 41.0 33.0 41.0 50 38.0385 40.0 38.0 41.0 34.0 41.0 51 38.00475 40.0 37.0 41.0 33.0 41.0 52 36.3645 39.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10 0.0 2203 11 0.0 2203 12 0.0 2203 13 0.0 2203 14 0.0 2203 15 0.0 2203 16 0.0 2203 17 0.0 2203 18 0.0 2203 19 0.0 2203 20 0.0 2203 21 0.0 2203 22 0.0 2203 23 0.0 2203 24 0.0 2203 25 0.0 2203 26 0.0 2203 27 0.0 2203 28 0.0 2203 29 0.0 2203 30 0.0 2203 31 0.0 2203 32 0.0 2203 33 0.0 2203 34 0.0 2203 35 0.0 2203 36 0.0 2203 37 0.0 2203 38 0.0 2203 39 0.0 2203 40 0.0 2203 41 0.0 2203 42 0.0 2203 43 0.0 2203 44 0.0 2203 45 0.0 2203 46 0.0 2203 47 0.0 2203 48 0.0 2203 49 0.0 2203 50 0.0 2203 51 0.0 2203 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 4.0 22 4.0 23 5.0 24 3.0 25 5.0 26 8.0 27 15.0 28 21.0 29 29.0 30 23.0 31 36.0 32 45.0 33 59.0 34 94.0 35 103.0 36 183.0 37 318.0 38 656.0 39 2373.0 40 15.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.00501882057716 12.898368883312422 5.370138017565872 33.72647427854454 2 23.3 15.5 34.275 26.924999999999997 3 18.775 21.75 27.125 32.35 4 23.724999999999998 28.999999999999996 23.474999999999998 23.799999999999997 5 23.625 32.1 24.224999999999998 20.05 6 20.9 30.7 23.775 24.625 7 16.125 21.125 42.05 20.7 8 18.925 19.900000000000002 30.925000000000004 30.25 9 19.875 18.95 32.425 28.749999999999996 10 19.85 36.9 22.625 20.625 11 25.874999999999996 23.849999999999998 20.375 29.9 12 24.275 20.65 25.374999999999996 29.7 13 21.175 25.35 28.175 25.3 14 22.05 25.275 27.625 25.05 15 22.075 24.4 26.700000000000003 26.825 16 21.7 24.575 26.474999999999998 27.250000000000004 17 23.200000000000003 23.35 26.575 26.875 18 21.275 23.65 26.875 28.199999999999996 19 21.425 26.575 25.474999999999998 26.525 20 20.849999999999998 25.775 26.650000000000002 26.724999999999998 21 23.0 24.8 24.925 27.275 22 23.200000000000003 25.15 25.324999999999996 26.325 23 22.825 23.25 26.924999999999997 27.0 24 21.75 23.599999999999998 27.1 27.55 25 23.849999999999998 25.05 25.374999999999996 25.724999999999998 26 22.175 24.425 25.825 27.575 27 21.45 24.75 26.924999999999997 26.875 28 22.925 24.9 24.6 27.575 29 22.375 24.875 25.174999999999997 27.575 30 21.925 24.2 26.8 27.075 31 22.85 24.7 24.55 27.900000000000002 32 21.85 24.6 26.5 27.05 33 22.05 24.05 26.200000000000003 27.700000000000003 34 22.400000000000002 24.224999999999998 25.25 28.125 35 22.650000000000002 23.95 27.474999999999998 25.924999999999997 36 22.900000000000002 24.349999999999998 24.9 27.85 37 22.45 23.724999999999998 25.674999999999997 28.15 38 22.6 22.875 26.375 28.15 39 22.725 24.05 25.324999999999996 27.900000000000002 40 22.225 25.624999999999996 25.85 26.3 41 22.825 24.15 25.75 27.275 42 23.05 23.425 25.6 27.925 43 22.925 23.825 27.150000000000002 26.1 44 23.0 24.2 25.974999999999998 26.825 45 23.75 23.95 24.7 27.6 46 23.625 25.1 25.35 25.924999999999997 47 23.974999999999998 23.925 25.85 26.25 48 22.475 23.849999999999998 26.55 27.125 49 22.5 23.875 26.5 27.125 50 23.425 22.475 26.3 27.800000000000004 51 23.025000000000002 24.4 25.174999999999997 27.400000000000002 52 23.150000000000002 24.7 25.650000000000002 26.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 2.5 21 4.0 22 4.5 23 5.0 24 7.5 25 10.0 26 7.5 27 5.0 28 12.5 29 20.0 30 29.5 31 39.0 32 43.5 33 48.0 34 60.5 35 73.0 36 81.0 37 89.0 38 94.5 39 130.0 40 160.0 41 196.5 42 233.0 43 268.5 44 304.0 45 315.5 46 327.0 47 359.5 48 392.0 49 399.0 50 406.0 51 405.5 52 405.0 53 381.5 54 358.0 55 315.0 56 272.0 57 253.0 58 234.0 59 206.0 60 178.0 61 151.0 62 124.0 63 90.5 64 50.0 65 43.0 66 35.0 67 27.0 68 29.5 69 32.0 70 21.5 71 11.0 72 14.0 73 17.0 74 14.0 75 11.0 76 9.0 77 7.0 78 5.0 79 3.0 80 2.0 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.86284677210267 93.4 2 2.6186155042779364 5.050000000000001 3 0.466683951257454 1.35 4 0.051853772361939325 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra Read 200000 spots for SRR5423492.sra Written 200000 spots for SRR5423492.sra SRR ids: ['SRR5423492.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tnwwxupq SRR5423492.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423492 file size 703961 SRR5423492 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423492 SRR5423492_1.fastq Input file: SRR5423492_1.fastq trimmed: SRR5423492-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 11:21:05 2025 >> started Thu Feb 13 11:22:15 2025 >> done (69.782s) 4000000 reads processed; of these: 216 ( 0.01%) short reads filtered out after trimming by size control 207 ( 0.01%) empty reads filtered out after trimming by size control 3999577 (99.99%) reads available; of these: 73192 ( 1.83%) trimmed reads available after processing 3926385 (98.17%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 12 0.00% 20 9 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 4 0.00% 25 10 0.00% 26 18 0.00% 27 17 0.00% 28 23 0.00% 29 31 0.00% 30 48 0.00% 31 43 0.00% 32 65 0.00% 33 68 0.00% 34 64 0.00% 35 76 0.00% 36 88 0.00% 37 117 0.00% 38 149 0.00% 39 127 0.00% 40 221 0.01% 41 269 0.01% 42 294 0.01% 43 376 0.01% 44 483 0.01% 45 1028 0.03% 46 1339 0.03% 47 1561 0.04% 48 1982 0.05% 49 3643 0.09% 50 8565 0.21% 51 52443 1.31% 52 3926385 98.17% 3999577 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=30 prefix-density=0.24 prefix-fanout=2.0 sequence=TTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=24.69 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=1.0 sequence=CCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGCCGACCTTGACCCCTGTTATTTTGAGGTCATATCTAGTATTCAGAGTTTGCCTCGATTTGGTACCGCTCTCGCGGCCCGCACCGAAACAGTGCTTTACCCCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCTCTGGGTTCGAGTGGCATTTCACCCCTAACCACAACTCATCCGCTGATTCTTCAACATCAGTCGGTTCGGACCTCCACTTAGTTTCACCC Started job on | Feb 13 11:22:33 Started mapping on | Feb 13 11:22:34 Finished on | Feb 13 11:22:40 Mapping speed, Million of reads per hour | 2399.75 Number of input reads | 3999577 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3207972 Uniquely mapped reads % | 80.21% Average mapped length | 51.85 Number of splices: Total | 399366 Number of splices: Annotated (sjdb) | 394825 Number of splices: GT/AG | 393059 Number of splices: GC/AG | 5671 Number of splices: AT/AC | 206 Number of splices: Non-canonical | 430 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330961 % of reads mapped to multiple loci | 8.27% Number of reads mapped to too many loci | 435780 % of reads mapped to too many loci | 10.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.62% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 460644 460644 460644 N_multimapping 330961 330961 330961 N_noFeature 194055 3169296 206097 N_ambiguous 39877 32 13230 UnstrandedReadsAssigned:2974040 PositiveStrandReadsAssigned:38644 NegativeStrandReadsAssigned:2988645 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423492 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423492-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,577 reads, 3,465,097 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52401 SRR5423492.ke.tsv 34699 SRR5423492.se.tsv 87100 total ==> SRR5423492.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 53 9.22573 Potri.005G024800.1.v4.1 1035 936 4.00472 1.42921 Potri.004G059700.1.v4.1 961 862 3.41668 1.32403 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 36.7985 4.32215 Potri.016G087400.1.v4.1 270 171 89 173.858 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 101 38.4261 ==> SRR5423492.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 62 Potri.001G212900.v4.1 71 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423492 completed mapping pipeline successfully