Starting /dee2/code/volunteer_pipeline.sh SRR5423493 current disk space = 3093256888320 free memory = 1345389128 SRR5423493 SRAfilesize fa914d4db0969a3474faaab252723d8a SRR5423493.sra SRR5423493.sra file validated SRR5423493 is single end SRR5423493 is conventional basespace SRR5423493 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423493_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3945 31.0 31.0 34.0 28.0 34.0 2 31.7815 31.0 31.0 34.0 30.0 34.0 3 31.96425 33.0 31.0 34.0 30.0 34.0 4 32.516 35.0 32.0 37.0 19.0 37.0 5 34.68425 35.0 35.0 37.0 30.0 37.0 6 35.222 37.0 35.0 37.0 32.0 37.0 7 35.3595 37.0 35.0 37.0 33.0 37.0 8 35.56575 37.0 35.0 37.0 33.0 37.0 9 37.3485 39.0 37.0 39.0 34.0 39.0 10 37.15475 39.0 37.0 39.0 33.0 39.0 11 37.24125 39.0 37.0 39.0 33.0 39.0 12 37.19475 39.0 37.0 39.0 33.0 39.0 13 37.187 39.0 37.0 39.0 33.0 39.0 14 38.268 40.0 38.0 41.0 33.0 41.0 15 38.5785 40.0 38.0 41.0 34.0 41.0 16 38.24975 40.0 38.0 41.0 33.0 41.0 17 38.3245 40.0 38.0 41.0 33.0 41.0 18 38.35575 40.0 38.0 41.0 33.0 41.0 19 38.522 40.0 38.0 41.0 34.0 41.0 20 38.578 40.0 38.0 41.0 34.0 41.0 21 38.48825 40.0 38.0 41.0 34.0 41.0 22 38.46575 40.0 38.0 41.0 34.0 41.0 23 38.195 40.0 38.0 41.0 33.0 41.0 24 38.39475 40.0 38.0 41.0 34.0 41.0 25 38.1865 40.0 38.0 41.0 33.0 41.0 26 38.3885 40.0 38.0 41.0 34.0 41.0 27 38.26825 40.0 38.0 41.0 33.0 41.0 28 38.1925 40.0 38.0 41.0 34.0 41.0 29 38.33075 40.0 38.0 41.0 34.0 41.0 30 38.24075 40.0 38.0 41.0 33.0 41.0 31 38.33975 40.0 38.0 41.0 34.0 41.0 32 38.23225 40.0 38.0 41.0 34.0 41.0 33 38.23775 40.0 38.0 41.0 34.0 41.0 34 38.16575 40.0 38.0 41.0 33.0 41.0 35 38.05475 40.0 37.0 41.0 33.0 41.0 36 38.09775 40.0 37.0 41.0 33.0 41.0 37 37.96325 40.0 37.0 41.0 33.0 41.0 38 37.98 40.0 37.0 41.0 33.0 41.0 39 37.7735 40.0 37.0 41.0 33.0 41.0 40 37.612 40.0 37.0 41.0 32.0 41.0 41 37.552 40.0 37.0 41.0 32.0 41.0 42 37.541 40.0 37.0 41.0 32.0 41.0 43 37.43875 40.0 37.0 41.0 31.0 41.0 44 37.36725 39.0 36.0 41.0 31.0 41.0 45 37.30275 39.0 36.0 41.0 31.0 41.0 46 37.3735 39.0 36.0 41.0 31.0 41.0 47 37.464 39.0 36.0 41.0 32.0 41.0 48 37.442 39.0 36.0 41.0 32.0 41.0 49 37.15925 39.0 36.0 41.0 31.0 41.0 50 36.979 39.0 36.0 41.0 31.0 41.0 51 37.04775 39.0 35.0 41.0 31.0 41.0 52 36.26525 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2214 1 0.0 2214 2 0.0 2214 3 0.0 2214 4 0.0 2214 5 0.0 2214 6 0.0 2214 7 0.0 2214 8 0.0 2214 9 0.0 2214 10 0.0 2214 11 0.0 2214 12 0.0 2214 13 0.0 2214 14 0.0 2214 15 0.0 2214 16 0.0 2214 17 0.0 2214 18 0.0 2214 19 0.0 2214 20 0.0 2214 21 0.0 2214 22 0.0 2214 23 0.0 2214 24 0.0 2214 25 0.0 2214 26 0.0 2214 27 0.0 2214 28 0.0 2214 29 0.0 2214 30 0.0 2214 31 0.0 2214 32 0.0 2214 33 0.0 2214 34 0.0 2214 35 0.0 2214 36 0.0 2214 37 0.0 2214 38 0.0 2214 39 0.0 2214 40 0.0 2214 41 0.0 2214 42 0.0 2214 43 0.0 2214 44 0.0 2214 45 0.0 2214 46 0.0 2214 47 0.0 2214 48 0.0 2214 49 0.0 2214 50 0.0 2214 51 0.0 2214 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 3.0 23 2.0 24 10.0 25 9.0 26 10.0 27 26.0 28 28.0 29 45.0 30 69.0 31 66.0 32 119.0 33 142.0 34 187.0 35 253.0 36 341.0 37 522.0 38 806.0 39 1354.0 40 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.286821705426355 15.028757189297323 4.82620655163791 32.85821455363841 2 22.35 16.6 34.925 26.125 3 19.05 21.65 27.775 31.525 4 24.7 27.650000000000002 24.5 23.150000000000002 5 23.65 33.2 22.875 20.275000000000002 6 20.275000000000002 32.625 22.7 24.4 7 17.025000000000002 20.549999999999997 42.15 20.275000000000002 8 19.525000000000002 19.625 30.225 30.625000000000004 9 19.1 19.825 32.175 28.9 10 20.25 35.5 23.474999999999998 20.775 11 25.575 25.525 19.475 29.425 12 23.225 22.375 24.8 29.599999999999998 13 20.7 24.75 28.875 25.674999999999997 14 22.375 24.375 27.750000000000004 25.5 15 21.5 24.175 26.174999999999997 28.15 16 22.525000000000002 25.1 26.125 26.25 17 22.85 24.675 26.275 26.200000000000003 18 22.625 23.400000000000002 26.174999999999997 27.800000000000004 19 21.8 26.400000000000002 24.175 27.625 20 22.775000000000002 25.1 25.0 27.125 21 22.3 23.425 27.425 26.85 22 21.875 25.3 25.650000000000002 27.175 23 22.675 24.625 25.75 26.950000000000003 24 21.775 24.349999999999998 26.125 27.750000000000004 25 23.325000000000003 26.025 24.95 25.7 26 21.275 25.1 26.950000000000003 26.674999999999997 27 21.925 24.125 26.875 27.075 28 23.325000000000003 23.925 26.1 26.650000000000002 29 23.825 24.325 25.75 26.1 30 21.75 25.25 27.150000000000002 25.85 31 23.75 25.224999999999998 25.025 26.0 32 22.025 24.85 26.900000000000002 26.224999999999998 33 21.475 23.799999999999997 26.775 27.950000000000003 34 21.75 25.7 25.624999999999996 26.924999999999997 35 24.5 23.799999999999997 26.125 25.575 36 21.7 24.474999999999998 24.95 28.875 37 24.3 24.9 25.25 25.55 38 23.225 23.925 25.900000000000002 26.950000000000003 39 22.45 23.0 25.7 28.849999999999998 40 22.35 25.15 25.35 27.150000000000002 41 23.45 23.375 26.375 26.8 42 24.175 22.875 25.775 27.175 43 24.425 24.2 25.174999999999997 26.200000000000003 44 21.2 24.2 26.5 28.1 45 22.875 23.575 25.174999999999997 28.375 46 22.586293146573286 25.312656328164078 26.088044022011005 26.013006503251624 47 23.1 23.875 26.700000000000003 26.325 48 22.28614307153577 24.062031015507753 25.287643821910955 28.36418209104552 49 23.836918459229615 24.187093546773387 24.81240620310155 27.163581790895446 50 21.875 25.674999999999997 26.05 26.400000000000002 51 23.5 23.724999999999998 26.25 26.525 52 23.325000000000003 24.75 25.424999999999997 26.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 2.5 21 4.0 22 4.5 23 5.0 24 4.5 25 4.0 26 7.5 27 11.0 28 15.5 29 20.0 30 25.0 31 30.0 32 33.0 33 36.0 34 54.0 35 72.0 36 91.0 37 110.0 38 120.5 39 153.5 40 176.0 41 207.5 42 239.0 43 272.0 44 305.0 45 317.5 46 330.0 47 345.0 48 360.0 49 381.0 50 402.0 51 388.0 52 374.0 53 374.0 54 374.0 55 332.5 56 291.0 57 269.0 58 247.0 59 204.5 60 162.0 61 143.5 62 125.0 63 87.5 64 47.5 65 45.0 66 39.0 67 33.0 68 24.5 69 16.0 70 17.0 71 18.0 72 14.5 73 11.0 74 11.5 75 12.0 76 6.0 77 0.0 78 2.5 79 5.0 80 2.5 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.05 47 0.0 48 0.05 49 0.05 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.375 #Duplication Level Percentage of deduplicated Percentage of total 1 97.01686121919585 93.5 2 2.4124513618677046 4.65 3 0.4150453955901427 1.2 4 0.10376134889753567 0.4 5 0.05188067444876784 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGAATACATCAGTGTAGCGCGCGTGCGGCCCAGAACATCTAAGGGCATCA 5 0.125 No Hit GATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra Read 200000 spots for SRR5423493.sra Written 200000 spots for SRR5423493.sra SRR ids: ['SRR5423493.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eau1x9wo SRR5423493.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423493 file size 703964 SRR5423493 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423493 SRR5423493_1.fastq Input file: SRR5423493_1.fastq trimmed: SRR5423493-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 11:22:09 2025 >> started Thu Feb 13 11:22:18 2025 >> done (8.660s) 4000000 reads processed; of these: 213 ( 0.01%) short reads filtered out after trimming by size control 210 ( 0.01%) empty reads filtered out after trimming by size control 3999577 (99.99%) reads available; of these: 76471 ( 1.91%) trimmed reads available after processing 3923106 (98.09%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 10 0.00% 21 2 0.00% 22 1 0.00% 23 4 0.00% 24 9 0.00% 25 9 0.00% 26 16 0.00% 27 13 0.00% 28 27 0.00% 29 31 0.00% 30 35 0.00% 31 80 0.00% 32 99 0.00% 33 97 0.00% 34 87 0.00% 35 75 0.00% 36 103 0.00% 37 149 0.00% 38 136 0.00% 39 174 0.00% 40 232 0.01% 41 302 0.01% 42 298 0.01% 43 391 0.01% 44 487 0.01% 45 902 0.02% 46 1410 0.04% 47 1534 0.04% 48 2156 0.05% 49 3955 0.10% 50 9274 0.23% 51 54358 1.36% 52 3923106 98.09% 3999577 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.23 prefix-fanout=2.0 sequence=TTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=12.11 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=2.3 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCT Started job on | Feb 13 11:22:38 Started mapping on | Feb 13 11:22:39 Finished on | Feb 13 11:22:45 Mapping speed, Million of reads per hour | 2399.75 Number of input reads | 3999577 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3210173 Uniquely mapped reads % | 80.26% Average mapped length | 51.84 Number of splices: Total | 399559 Number of splices: Annotated (sjdb) | 395198 Number of splices: GT/AG | 393282 Number of splices: GC/AG | 5640 Number of splices: AT/AC | 225 Number of splices: Non-canonical | 412 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330267 % of reads mapped to multiple loci | 8.26% Number of reads mapped to too many loci | 433891 % of reads mapped to too many loci | 10.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.63% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 459137 459137 459137 N_multimapping 330267 330267 330267 N_noFeature 193436 3171789 205426 N_ambiguous 39457 31 13047 UnstrandedReadsAssigned:2977280 PositiveStrandReadsAssigned:38353 NegativeStrandReadsAssigned:2991700 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423493 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423493-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,577 reads, 3,456,414 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR5423493.ke.tsv 34699 SRR5423493.se.tsv 87100 total ==> SRR5423493.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 49 8.55246 Potri.005G024800.1.v4.1 1035 936 6 2.14707 Potri.004G059700.1.v4.1 961 862 5 1.94282 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 38.8223 4.57217 Potri.016G087400.1.v4.1 270 171 83 162.574 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 114 43.4891 ==> SRR5423493.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 70 Potri.001G212900.v4.1 77 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423493 completed mapping pipeline successfully