Starting /dee2/code/volunteer_pipeline.sh SRR5423494 current disk space = 3093378985984 free memory = 1450141728 SRR5423494 SRAfilesize 2ea99e57f0579720cc77588b0a76927f SRR5423494.sra SRR5423494.sra file validated SRR5423494 is single end SRR5423494 is conventional basespace SRR5423494 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423494_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1065 33.0 31.0 34.0 30.0 34.0 2 32.2 34.0 31.0 34.0 30.0 34.0 3 32.30675 34.0 31.0 34.0 30.0 34.0 4 34.89275 37.0 35.0 37.0 32.0 37.0 5 35.5805 37.0 35.0 37.0 33.0 37.0 6 35.65625 37.0 35.0 37.0 33.0 37.0 7 35.787 37.0 35.0 37.0 35.0 37.0 8 35.93175 37.0 35.0 37.0 35.0 37.0 9 37.67525 39.0 37.0 39.0 35.0 39.0 10 37.49075 39.0 37.0 39.0 35.0 39.0 11 37.544 39.0 37.0 39.0 35.0 39.0 12 37.56975 39.0 37.0 39.0 35.0 39.0 13 37.4805 39.0 37.0 39.0 35.0 39.0 14 38.93725 40.0 38.0 41.0 36.0 41.0 15 38.805 40.0 38.0 41.0 34.0 41.0 16 38.44125 40.0 38.0 41.0 34.0 41.0 17 38.62075 40.0 38.0 41.0 34.0 41.0 18 38.743 40.0 38.0 41.0 35.0 41.0 19 38.428 40.0 38.0 41.0 34.0 41.0 20 38.58825 40.0 38.0 41.0 34.0 41.0 21 38.592 40.0 38.0 41.0 34.0 41.0 22 38.729 40.0 38.0 41.0 34.0 41.0 23 38.7675 40.0 38.0 41.0 35.0 41.0 24 38.76675 40.0 38.0 41.0 34.0 41.0 25 38.73425 40.0 38.0 41.0 34.0 41.0 26 38.61 40.0 38.0 41.0 34.0 41.0 27 38.7005 40.0 38.0 41.0 34.0 41.0 28 38.44625 40.0 38.0 41.0 34.0 41.0 29 38.62475 40.0 38.0 41.0 35.0 41.0 30 38.4785 40.0 38.0 41.0 34.0 41.0 31 38.48475 40.0 38.0 41.0 34.0 41.0 32 38.546 40.0 38.0 41.0 34.0 41.0 33 38.59975 40.0 38.0 41.0 34.0 41.0 34 38.43175 40.0 38.0 41.0 34.0 41.0 35 38.2615 40.0 38.0 41.0 34.0 41.0 36 38.2975 40.0 38.0 41.0 34.0 41.0 37 38.18 40.0 38.0 41.0 33.0 41.0 38 38.20075 40.0 38.0 41.0 33.0 41.0 39 38.21825 40.0 38.0 41.0 33.0 41.0 40 37.80025 40.0 37.0 41.0 32.0 41.0 41 37.897 40.0 37.0 41.0 33.0 41.0 42 37.92125 40.0 37.0 41.0 33.0 41.0 43 37.95775 40.0 37.0 41.0 33.0 41.0 44 37.5355 40.0 37.0 41.0 32.0 41.0 45 37.74925 40.0 37.0 41.0 33.0 41.0 46 37.892 40.0 37.0 41.0 33.0 41.0 47 37.6215 40.0 37.0 41.0 32.0 41.0 48 37.4845 40.0 36.0 41.0 32.0 41.0 49 37.33575 40.0 36.0 41.0 31.0 41.0 50 37.38025 39.0 36.0 41.0 32.0 41.0 51 37.3175 39.0 36.0 41.0 31.0 41.0 52 36.535 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10 0.0 2309 11 0.0 2309 12 0.0 2309 13 0.0 2309 14 0.0 2309 15 0.0 2309 16 0.0 2309 17 0.0 2309 18 0.0 2309 19 0.0 2309 20 0.0 2309 21 0.0 2309 22 0.0 2309 23 0.0 2309 24 0.0 2309 25 0.0 2309 26 0.0 2309 27 0.0 2309 28 0.0 2309 29 0.0 2309 30 0.0 2309 31 0.0 2309 32 0.0 2309 33 0.0 2309 34 0.0 2309 35 0.0 2309 36 0.0 2309 37 0.0 2309 38 0.0 2309 39 0.0 2309 40 0.0 2309 41 0.0 2309 42 0.0 2309 43 0.0 2309 44 0.0 2309 45 0.0 2309 46 0.0 2309 47 0.0 2309 48 0.0 2309 49 0.0 2309 50 0.0 2309 51 0.0 2309 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 2.0 22 4.0 23 0.0 24 3.0 25 8.0 26 14.0 27 15.0 28 18.0 29 36.0 30 54.0 31 77.0 32 90.0 33 123.0 34 142.0 35 230.0 36 291.0 37 437.0 38 776.0 39 1666.0 40 10.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.483103879849814 13.667083854818523 5.55694618272841 34.292866082603254 2 21.475 17.2 33.725 27.6 3 18.975 23.25 26.174999999999997 31.6 4 23.95 29.625 22.425 24.0 5 22.975 34.2 22.425 20.4 6 19.275000000000002 33.300000000000004 23.575 23.849999999999998 7 15.35 21.5 42.225 20.925 8 19.225 19.85 30.525000000000002 30.4 9 18.6 18.2 32.85 30.349999999999998 10 20.25 35.15 23.175 21.425 11 24.525 24.8 21.025 29.65 12 22.1 21.4 24.474999999999998 32.025 13 20.175 24.95 27.750000000000004 27.125 14 20.75 25.45 27.425 26.375 15 23.0 23.875 26.525 26.6 16 22.925 24.7 25.674999999999997 26.700000000000003 17 22.1 26.125 25.624999999999996 26.150000000000002 18 21.9 24.375 26.325 27.400000000000002 19 22.7 25.3 24.925 27.075 20 23.05 24.775 25.8 26.375 21 21.675 24.8 27.025 26.5 22 22.175 25.75 26.0 26.075 23 22.775000000000002 24.65 25.775 26.8 24 22.325 24.425 25.6 27.650000000000002 25 23.125 25.624999999999996 25.275 25.974999999999998 26 22.650000000000002 24.05 26.474999999999998 26.825 27 22.275 24.6 26.150000000000002 26.974999999999998 28 22.1 24.0 25.55 28.349999999999998 29 21.425 25.575 26.875 26.125 30 21.3 23.225 27.900000000000002 27.575 31 21.425 23.75 26.150000000000002 28.675 32 22.25 24.575 27.35 25.825 33 23.225 23.825 26.400000000000002 26.55 34 22.725 24.224999999999998 25.074999999999996 27.975 35 22.725 24.175 26.900000000000002 26.200000000000003 36 22.05 24.5 26.174999999999997 27.275 37 22.625 25.05 24.875 27.450000000000003 38 23.025000000000002 24.275 26.3 26.400000000000002 39 22.075 23.025000000000002 26.325 28.575 40 22.75 25.174999999999997 25.45 26.625 41 23.549999999999997 24.0 24.375 28.075 42 23.175 23.425 26.474999999999998 26.924999999999997 43 23.225 23.825 26.974999999999998 25.974999999999998 44 22.975 24.8 25.7 26.525 45 22.0 24.925 25.75 27.325 46 22.55 23.974999999999998 26.200000000000003 27.275 47 23.23080770192548 22.53063265816454 26.18154538634659 28.057014253563388 48 22.975 24.099999999999998 26.375 26.55 49 23.849999999999998 22.875 25.900000000000002 27.375 50 22.675 24.375 26.825 26.125 51 22.875 23.474999999999998 26.0 27.650000000000002 52 22.175 24.3 26.325 27.200000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 2.0 18 1.0 19 0.0 20 1.5 21 3.0 22 4.5 23 6.0 24 6.0 25 6.0 26 8.0 27 10.0 28 13.0 29 16.0 30 19.0 31 22.0 32 31.0 33 40.0 34 51.5 35 63.0 36 83.5 37 104.0 38 118.0 39 158.0 40 184.0 41 214.0 42 244.0 43 263.5 44 283.0 45 319.0 46 355.0 47 386.5 48 418.0 49 399.5 50 381.0 51 391.5 52 402.0 53 374.5 54 347.0 55 318.0 56 289.0 57 257.0 58 225.0 59 198.5 60 172.0 61 134.0 62 96.0 63 71.5 64 47.5 65 48.0 66 39.0 67 30.0 68 28.0 69 26.0 70 22.0 71 18.0 72 16.0 73 14.0 74 12.0 75 10.0 76 6.5 77 3.0 78 2.0 79 1.0 80 0.5 81 0.0 82 1.0 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.025 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.7 #Duplication Level Percentage of deduplicated Percentage of total 1 97.51809720785936 94.3 2 1.938986556359876 3.75 3 0.2843846949327818 0.8250000000000001 4 0.12926577042399173 0.5 5 0.12926577042399173 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACGT 5 0.125 No Hit GGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCAC 5 0.125 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 5 0.125 No Hit CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTA 5 0.125 No Hit GTCGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144093 spots for SRR5423494.sra Written 144093 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra Read 144092 spots for SRR5423494.sra Written 144092 spots for SRR5423494.sra SRR ids: ['SRR5423494.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1uwmd65u SRR5423494.sra spots: 2881841 blocks: [[1, 144092], [144093, 288184], [288185, 432276], [432277, 576368], [576369, 720460], [720461, 864552], [864553, 1008644], [1008645, 1152736], [1152737, 1296828], [1296829, 1440920], [1440921, 1585012], [1585013, 1729104], [1729105, 1873196], [1873197, 2017288], [2017289, 2161380], [2161381, 2305472], [2305473, 2449564], [2449565, 2593656], [2593657, 2737748], [2737749, 2881841]] SRR5423494 file size 506876 SRR5423494 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423494 SRR5423494_1.fastq Input file: SRR5423494_1.fastq trimmed: SRR5423494-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 11:30:44 2025 >> started Thu Feb 13 11:30:45 2025 >> done (1.443s) 2881841 reads processed; of these: 148 ( 0.01%) short reads filtered out after trimming by size control 126 ( 0.00%) empty reads filtered out after trimming by size control 2881567 (99.99%) reads available; of these: 45910 ( 1.59%) trimmed reads available after processing 2835657 (98.41%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 2 0.00% 20 4 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 1 0.00% 26 2 0.00% 27 4 0.00% 28 0 0.00% 29 3 0.00% 30 5 0.00% 31 6 0.00% 32 9 0.00% 33 17 0.00% 34 18 0.00% 35 14 0.00% 36 24 0.00% 37 16 0.00% 38 19 0.00% 39 43 0.00% 40 37 0.00% 41 48 0.00% 42 70 0.00% 43 87 0.00% 44 128 0.00% 45 229 0.01% 46 431 0.01% 47 456 0.02% 48 743 0.03% 49 1841 0.06% 50 5195 0.18% 51 36447 1.26% 52 2835657 98.41% 2881567 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.24 prefix-fanout=2.0 sequence=TTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=27.90 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=1.1 sequence=CCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGCCGACCTTGACCCCTGTTATTTTGAGGTCATATCTAGTATTCAGAGTTTGCCTCGATTTGGTACCGCTCTCGCGGCCCGCACCGAAACAGTGCTTTACCCCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCTCTGGGTTCGAGTGGCATTTCACCCCTAACCACAACTCATCCGCTGATTCTTCAACATCAGTCGGTTCGGACCTCCACTTAGTTTCACCC Started job on | Feb 13 11:30:58 Started mapping on | Feb 13 11:30:59 Finished on | Feb 13 11:31:03 Mapping speed, Million of reads per hour | 2593.41 Number of input reads | 2881567 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2308903 Uniquely mapped reads % | 80.13% Average mapped length | 51.85 Number of splices: Total | 286451 Number of splices: Annotated (sjdb) | 283375 Number of splices: GT/AG | 281896 Number of splices: GC/AG | 4088 Number of splices: AT/AC | 172 Number of splices: Non-canonical | 295 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 237390 % of reads mapped to multiple loci | 8.24% Number of reads mapped to too many loci | 318484 % of reads mapped to too many loci | 11.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.58% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 335274 335274 335274 N_multimapping 237390 237390 237390 N_noFeature 141205 2281277 149927 N_ambiguous 28377 34 9460 UnstrandedReadsAssigned:2139321 PositiveStrandReadsAssigned:27592 NegativeStrandReadsAssigned:2149516 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423494 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423494-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,881,567 reads, 2,492,661 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR5423494.ke.tsv 34699 SRR5423494.se.tsv 87100 total ==> SRR5423494.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 28 6.79251 Potri.005G024800.1.v4.1 1035 936 3 1.49208 Potri.004G059700.1.v4.1 961 862 4 2.16023 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 28.1879 4.61403 Potri.016G087400.1.v4.1 270 171 80 217.792 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 91 48.2497 ==> SRR5423494.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 42 Potri.001G212900.v4.1 52 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423494 completed mapping pipeline successfully