Starting /dee2/code/volunteer_pipeline.sh SRR5423495 current disk space = 3092667203584 free memory = 1580017460 SRR5423495 SRAfilesize d1bc9eda3e0034254c7b692086889772 SRR5423495.sra SRR5423495.sra file validated SRR5423495 is single end SRR5423495 is conventional basespace SRR5423495 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423495_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.39525 34.0 31.0 34.0 28.0 34.0 2 31.6565 34.0 31.0 34.0 27.0 34.0 3 32.5615 34.0 31.0 34.0 28.0 34.0 4 36.1185 37.0 35.0 37.0 35.0 37.0 5 36.18 37.0 37.0 37.0 35.0 37.0 6 36.2655 37.0 37.0 37.0 35.0 37.0 7 36.28675 37.0 37.0 37.0 35.0 37.0 8 36.2835 37.0 37.0 37.0 35.0 37.0 9 38.101 39.0 38.0 39.0 37.0 39.0 10 37.962 39.0 38.0 39.0 35.0 39.0 11 37.8975 39.0 38.0 39.0 35.0 39.0 12 38.03775 39.0 38.0 39.0 35.0 39.0 13 37.93375 39.0 38.0 39.0 35.0 39.0 14 39.54325 41.0 39.0 41.0 36.0 41.0 15 39.43925 41.0 39.0 41.0 37.0 41.0 16 39.34475 41.0 39.0 41.0 36.0 41.0 17 39.374 41.0 39.0 41.0 36.0 41.0 18 39.42 41.0 39.0 41.0 36.0 41.0 19 39.43325 41.0 39.0 41.0 36.0 41.0 20 39.34 41.0 39.0 41.0 36.0 41.0 21 39.3115 41.0 39.0 41.0 36.0 41.0 22 39.311 41.0 39.0 41.0 36.0 41.0 23 39.293 41.0 39.0 41.0 36.0 41.0 24 39.23425 41.0 39.0 41.0 36.0 41.0 25 39.305 41.0 39.0 41.0 36.0 41.0 26 39.127 41.0 39.0 41.0 36.0 41.0 27 39.119 40.0 39.0 41.0 36.0 41.0 28 39.146 41.0 39.0 41.0 36.0 41.0 29 39.01225 41.0 39.0 41.0 36.0 41.0 30 38.98 40.0 39.0 41.0 36.0 41.0 31 38.9455 40.0 39.0 41.0 35.0 41.0 32 38.87775 40.0 39.0 41.0 35.0 41.0 33 38.826 40.0 39.0 41.0 35.0 41.0 34 38.81675 40.0 39.0 41.0 35.0 41.0 35 38.785 40.0 38.0 41.0 35.0 41.0 36 38.7245 40.0 38.0 41.0 35.0 41.0 37 38.6385 40.0 38.0 41.0 35.0 41.0 38 38.5645 40.0 38.0 41.0 35.0 41.0 39 38.5165 40.0 38.0 41.0 34.0 41.0 40 38.32125 40.0 38.0 41.0 34.0 41.0 41 38.19625 40.0 38.0 41.0 33.0 41.0 42 38.0285 40.0 38.0 41.0 33.0 41.0 43 37.98525 40.0 38.0 41.0 33.0 41.0 44 38.0875 40.0 38.0 41.0 33.0 41.0 45 38.041 40.0 38.0 41.0 33.0 41.0 46 37.9915 40.0 38.0 41.0 33.0 41.0 47 37.81575 40.0 37.0 41.0 33.0 41.0 48 37.69925 40.0 37.0 41.0 32.0 41.0 49 37.59475 40.0 37.0 41.0 32.0 41.0 50 37.59225 40.0 37.0 41.0 32.0 41.0 51 37.47125 40.0 37.0 41.0 32.0 41.0 52 35.55075 38.0 34.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 2.0 21 2.0 22 2.0 23 4.0 24 3.0 25 10.0 26 14.0 27 18.0 28 20.0 29 33.0 30 41.0 31 52.0 32 49.0 33 86.0 34 115.0 35 151.0 36 244.0 37 350.0 38 797.0 39 2002.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.29379760609358 12.241566920565832 5.984766050054406 36.47986942328618 2 23.275000000000002 15.725 35.925000000000004 25.074999999999996 3 20.125 20.025000000000002 27.3 32.550000000000004 4 24.6 27.474999999999998 22.525000000000002 25.4 5 24.2 33.0 22.650000000000002 20.150000000000002 6 20.349999999999998 32.625 22.8 24.224999999999998 7 17.625 20.599999999999998 41.3 20.474999999999998 8 19.425 20.25 30.2 30.125 9 20.575 19.2 31.75 28.475 10 20.75 35.15 22.95 21.15 11 24.675 24.55 20.175 30.599999999999998 12 23.075000000000003 20.025000000000002 26.525 30.375000000000004 13 21.224999999999998 23.925 28.999999999999996 25.85 14 21.175 25.724999999999998 28.1 25.0 15 22.400000000000002 24.975 25.75 26.875 16 22.95 25.174999999999997 25.224999999999998 26.650000000000002 17 21.95 26.35 26.5 25.2 18 22.425 24.7 25.924999999999997 26.950000000000003 19 22.85 25.924999999999997 25.025 26.200000000000003 20 23.925 25.45 25.15 25.474999999999998 21 21.675 25.15 26.125 27.05 22 23.65 24.625 24.7 27.025 23 23.35 24.7 26.05 25.900000000000002 24 23.35 23.9 26.25 26.5 25 23.025000000000002 24.925 24.625 27.425 26 23.375 23.775 25.5 27.35 27 22.7 24.175 25.15 27.975 28 23.125 25.8 24.825 26.25 29 22.825 25.074999999999996 25.624999999999996 26.474999999999998 30 22.2 25.074999999999996 25.8 26.924999999999997 31 22.875 25.825 25.650000000000002 25.650000000000002 32 23.175 25.224999999999998 26.0 25.6 33 22.8 23.549999999999997 25.4 28.249999999999996 34 23.075000000000003 24.25 25.6 27.075 35 22.975 24.25 25.525 27.250000000000004 36 22.125 24.275 25.3 28.299999999999997 37 22.525000000000002 25.324999999999996 24.15 28.000000000000004 38 22.95 24.25 25.575 27.224999999999998 39 22.7 23.150000000000002 25.900000000000002 28.249999999999996 40 23.1 24.975 25.825 26.1 41 23.724999999999998 24.25 26.125 25.900000000000002 42 22.475 25.1 25.424999999999997 27.0 43 23.400000000000002 25.025 24.175 27.400000000000002 44 22.475 24.125 26.6 26.8 45 24.4 24.125 24.55 26.924999999999997 46 24.575 25.3 24.3 25.825 47 23.525 24.975 26.1 25.4 48 22.825 24.125 25.674999999999997 27.375 49 21.7 25.874999999999996 25.95 26.474999999999998 50 22.375 24.6 26.200000000000003 26.825 51 24.775 23.9 24.25 27.075 52 23.45 24.25 24.675 27.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.5 23 5.0 24 6.0 25 7.0 26 8.5 27 10.0 28 14.5 29 19.0 30 27.0 31 35.0 32 41.5 33 48.0 34 62.0 35 76.0 36 83.0 37 90.0 38 102.5 39 138.0 40 161.0 41 197.5 42 234.0 43 268.0 44 302.0 45 312.0 46 322.0 47 349.5 48 377.0 49 378.5 50 380.0 51 388.0 52 396.0 53 387.5 54 379.0 55 347.0 56 315.0 57 281.0 58 247.0 59 208.0 60 169.0 61 141.5 62 114.0 63 90.5 64 55.5 65 44.0 66 36.0 67 28.0 68 23.5 69 19.0 70 16.0 71 13.0 72 12.5 73 12.0 74 11.0 75 10.0 76 5.5 77 1.0 78 2.0 79 3.0 80 2.0 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.1 #Duplication Level Percentage of deduplicated Percentage of total 1 97.70854788877446 94.875 2 1.8537590113285274 3.5999999999999996 3 0.28321318228630277 0.8250000000000001 4 0.10298661174047373 0.4 5 0.0 0.0 6 0.051493305870236865 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTG 6 0.15 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra Read 200000 spots for SRR5423495.sra Written 200000 spots for SRR5423495.sra SRR ids: ['SRR5423495.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zehjhisv SRR5423495.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423495 file size 704002 SRR5423495 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423495 SRR5423495_1.fastq Input file: SRR5423495_1.fastq trimmed: SRR5423495-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:08:19 2025 >> started Thu Feb 13 12:08:20 2025 >> done (1.849s) 4000000 reads processed; of these: 175 ( 0.00%) short reads filtered out after trimming by size control 141 ( 0.00%) empty reads filtered out after trimming by size control 3999684 (99.99%) reads available; of these: 63175 ( 1.58%) trimmed reads available after processing 3936509 (98.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 7 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 1 0.00% 26 5 0.00% 27 8 0.00% 28 10 0.00% 29 12 0.00% 30 10 0.00% 31 13 0.00% 32 31 0.00% 33 29 0.00% 34 17 0.00% 35 23 0.00% 36 37 0.00% 37 48 0.00% 38 43 0.00% 39 54 0.00% 40 92 0.00% 41 104 0.00% 42 125 0.00% 43 165 0.00% 44 247 0.01% 45 394 0.01% 46 613 0.02% 47 747 0.02% 48 1132 0.03% 49 2440 0.06% 50 6930 0.17% 51 49822 1.25% 52 3936509 98.42% 3999684 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=31 prefix-density=0.21 prefix-fanout=2.0 sequence=CTACCATTCTTGAGTTCCTTCACCTTCAACTCAGCGAATGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=20.61 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.8 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 13 12:08:34 Started mapping on | Feb 13 12:08:34 Finished on | Feb 13 12:08:46 Mapping speed, Million of reads per hour | 1199.91 Number of input reads | 3999684 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3423122 Uniquely mapped reads % | 85.58% Average mapped length | 51.85 Number of splices: Total | 413189 Number of splices: Annotated (sjdb) | 409504 Number of splices: GT/AG | 406514 Number of splices: GC/AG | 6121 Number of splices: AT/AC | 192 Number of splices: Non-canonical | 362 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 341001 % of reads mapped to multiple loci | 8.53% Number of reads mapped to too many loci | 224245 % of reads mapped to too many loci | 5.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.28% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 235561 235561 235561 N_multimapping 341001 341001 341001 N_noFeature 157697 3386365 170072 N_ambiguous 41283 21 16893 UnstrandedReadsAssigned:3224142 PositiveStrandReadsAssigned:36736 NegativeStrandReadsAssigned:3236157 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423495 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423495-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,684 reads, 3,578,320 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR5423495.ke.tsv 34699 SRR5423495.se.tsv 87100 total ==> SRR5423495.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 48 7.85171 Potri.005G024800.1.v4.1 1035 936 2.00202 0.671413 Potri.004G059700.1.v4.1 961 862 3 1.09248 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 40.5157 4.47189 Potri.016G087400.1.v4.1 270 171 73 134.006 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 76 27.1717 ==> SRR5423495.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 53 Potri.001G212900.v4.1 17 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423495 completed mapping pipeline successfully