Starting /dee2/code/volunteer_pipeline.sh SRR5423496 current disk space = 3092524097536 free memory = 1582111980 SRR5423496 SRAfilesize cad15824e3b5eb1d49578c9ca6052318 SRR5423496.sra SRR5423496.sra file validated SRR5423496 is single end SRR5423496 is conventional basespace SRR5423496 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423496_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.01675 33.0 31.0 34.0 30.0 34.0 2 32.21175 34.0 31.0 34.0 30.0 34.0 3 32.223 34.0 31.0 34.0 30.0 34.0 4 35.522 37.0 35.0 37.0 33.0 37.0 5 35.72125 37.0 35.0 37.0 33.0 37.0 6 35.7255 37.0 35.0 37.0 33.0 37.0 7 35.7775 37.0 35.0 37.0 35.0 37.0 8 35.76125 37.0 35.0 37.0 35.0 37.0 9 37.406 39.0 37.0 39.0 34.0 39.0 10 37.41075 39.0 37.0 39.0 34.0 39.0 11 37.34375 39.0 37.0 39.0 34.0 39.0 12 37.41775 39.0 37.0 39.0 34.0 39.0 13 37.297 39.0 37.0 39.0 34.0 39.0 14 38.696 40.0 38.0 41.0 34.0 41.0 15 38.61575 40.0 38.0 41.0 34.0 41.0 16 38.53525 40.0 38.0 41.0 34.0 41.0 17 38.566 40.0 38.0 41.0 34.0 41.0 18 38.361 40.0 38.0 41.0 33.0 41.0 19 38.493 40.0 38.0 41.0 34.0 41.0 20 38.591 40.0 38.0 41.0 34.0 41.0 21 38.59875 40.0 38.0 41.0 34.0 41.0 22 38.5525 40.0 38.0 41.0 34.0 41.0 23 38.5675 40.0 38.0 41.0 34.0 41.0 24 38.56875 40.0 38.0 41.0 34.0 41.0 25 38.473 40.0 38.0 41.0 34.0 41.0 26 38.50325 40.0 38.0 41.0 34.0 41.0 27 38.36325 40.0 38.0 41.0 34.0 41.0 28 38.438 40.0 38.0 41.0 34.0 41.0 29 38.39175 40.0 38.0 41.0 34.0 41.0 30 38.34625 40.0 38.0 41.0 34.0 41.0 31 38.366 40.0 38.0 41.0 34.0 41.0 32 38.32575 40.0 38.0 41.0 34.0 41.0 33 38.35875 40.0 38.0 41.0 34.0 41.0 34 38.22525 40.0 38.0 41.0 33.0 41.0 35 38.24825 40.0 38.0 41.0 34.0 41.0 36 38.1215 40.0 38.0 41.0 33.0 41.0 37 37.9875 40.0 38.0 41.0 33.0 41.0 38 37.96325 40.0 37.0 41.0 33.0 41.0 39 37.931 40.0 37.0 41.0 33.0 41.0 40 37.882 40.0 37.0 41.0 33.0 41.0 41 37.8415 40.0 37.0 41.0 33.0 41.0 42 37.8155 40.0 37.0 41.0 33.0 41.0 43 37.6705 40.0 37.0 41.0 33.0 41.0 44 37.4975 40.0 37.0 41.0 32.0 41.0 45 37.467 40.0 36.0 41.0 31.0 41.0 46 37.348 40.0 36.0 41.0 31.0 41.0 47 37.31275 39.0 36.0 41.0 31.0 41.0 48 37.28075 39.0 36.0 41.0 31.0 41.0 49 37.24375 39.0 36.0 41.0 31.0 41.0 50 37.14025 39.0 36.0 41.0 31.0 41.0 51 37.27025 39.0 36.0 41.0 31.0 41.0 52 36.23725 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1112 1 0.0 1112 2 0.0 1112 3 0.0 1112 4 0.0 1112 5 0.0 1112 6 0.0 1112 7 0.0 1112 8 0.0 1112 9 0.0 1112 10 0.0 1112 11 0.0 1112 12 0.0 1112 13 0.0 1112 14 0.0 1112 15 0.0 1112 16 0.0 1112 17 0.0 1112 18 0.0 1112 19 0.0 1112 20 0.0 1112 21 0.0 1112 22 0.0 1112 23 0.0 1112 24 0.0 1112 25 0.0 1112 26 0.0 1112 27 0.0 1112 28 0.0 1112 29 0.0 1112 30 0.0 1112 31 0.0 1112 32 0.0 1112 33 0.0 1112 34 0.0 1112 35 0.0 1112 36 0.0 1112 37 0.0 1112 38 0.0 1112 39 0.0 1112 40 0.0 1112 41 0.0 1112 42 0.0 1112 43 0.0 1112 44 0.0 1112 45 0.0 1112 46 0.0 1112 47 0.0 1112 48 0.0 1112 49 0.0 1112 50 0.0 1112 51 0.0 1112 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 2.0 23 4.0 24 10.0 25 7.0 26 16.0 27 22.0 28 28.0 29 28.0 30 59.0 31 65.0 32 98.0 33 149.0 34 163.0 35 222.0 36 315.0 37 471.0 38 707.0 39 1623.0 40 9.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.01830032589621 13.411882677362746 7.320130358485836 36.2496866382552 2 23.974999999999998 17.1 33.900000000000006 25.025 3 19.0 21.224999999999998 25.8 33.975 4 23.125 29.049999999999997 23.5 24.325 5 24.675 33.225 21.575 20.525 6 19.375 32.775 24.975 22.875 7 17.4 20.775 40.150000000000006 21.675 8 19.225 19.675 30.075000000000003 31.025000000000002 9 19.75 20.474999999999998 30.725 29.049999999999997 10 21.3 35.699999999999996 23.175 19.825 11 26.775 25.775 19.825 27.625 12 23.05 21.325 25.624999999999996 30.0 13 19.950000000000003 25.525 27.900000000000002 26.625 14 21.224999999999998 23.775 27.700000000000003 27.3 15 22.85 24.075 25.95 27.125 16 22.8 24.975 25.474999999999998 26.75 17 23.150000000000002 24.95 25.025 26.875 18 23.0 23.974999999999998 25.575 27.450000000000003 19 23.425 25.1 24.95 26.525 20 22.925 25.074999999999996 26.6 25.4 21 23.055763940985248 23.755938984746187 25.806451612903224 27.38184546136534 22 23.375 23.974999999999998 26.575 26.075 23 22.7 25.974999999999998 25.25 26.075 24 21.725 25.4 26.974999999999998 25.900000000000002 25 24.474999999999998 25.224999999999998 24.525 25.775 26 23.35 24.95 25.4 26.3 27 21.6 25.15 26.174999999999997 27.075 28 22.8 24.65 25.3 27.250000000000004 29 22.475 25.55 24.875 27.1 30 22.875 23.575 26.424999999999997 27.125 31 22.575 25.674999999999997 25.025 26.724999999999998 32 23.150000000000002 25.05 24.95 26.85 33 22.075 24.15 26.35 27.425 34 22.45 24.725 26.075 26.75 35 23.575 25.05 25.224999999999998 26.150000000000002 36 24.224999999999998 25.05 23.549999999999997 27.175 37 22.45 26.924999999999997 25.374999999999996 25.25 38 23.425 25.724999999999998 24.95 25.900000000000002 39 24.099999999999998 22.5 26.025 27.375 40 23.724999999999998 24.375 23.775 28.125 41 23.35 24.425 26.35 25.874999999999996 42 22.13053263315829 23.455863965991497 26.281570392598148 28.132033008252062 43 23.325000000000003 23.95 25.45 27.275 44 23.400000000000002 26.05 25.75 24.8 45 23.925 23.150000000000002 26.450000000000003 26.474999999999998 46 23.7 25.2 25.6 25.5 47 25.3 23.75 23.925 27.025 48 22.175 23.200000000000003 26.575 28.050000000000004 49 24.05 24.175 25.525 26.25 50 24.45 23.775 26.25 25.525 51 23.05 23.875 24.875 28.199999999999996 52 23.875 23.225 25.05 27.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 2.0 22 3.5 23 5.0 24 4.5 25 4.0 26 4.0 27 4.0 28 10.5 29 17.0 30 24.0 31 31.0 32 36.5 33 42.0 34 54.5 35 67.0 36 78.5 37 90.0 38 107.5 39 160.5 40 196.0 41 192.5 42 189.0 43 232.5 44 276.0 45 303.5 46 331.0 47 338.5 48 346.0 49 392.0 50 438.0 51 401.5 52 365.0 53 388.5 54 412.0 55 370.5 56 329.0 57 289.5 58 250.0 59 210.0 60 170.0 61 152.0 62 134.0 63 90.5 64 44.0 65 41.0 66 33.5 67 26.0 68 21.5 69 17.0 70 20.0 71 23.0 72 15.5 73 8.0 74 7.5 75 7.0 76 5.0 77 3.0 78 1.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.025 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.025 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.30290456431536 93.8 2 2.1265560165975104 4.1000000000000005 3 0.38900414937759337 1.125 4 0.1296680497925311 0.5 5 0.0 0.0 6 0.025933609958506226 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025933609958506226 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 13 0.325 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra Read 200000 spots for SRR5423496.sra Written 200000 spots for SRR5423496.sra SRR ids: ['SRR5423496.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bo1yc1xl SRR5423496.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423496 file size 703980 SRR5423496 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423496 SRR5423496_1.fastq Input file: SRR5423496_1.fastq trimmed: SRR5423496-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:13:32 2025 >> started Thu Feb 13 12:13:34 2025 >> done (1.840s) 4000000 reads processed; of these: 214 ( 0.01%) short reads filtered out after trimming by size control 135 ( 0.00%) empty reads filtered out after trimming by size control 3999651 (99.99%) reads available; of these: 73134 ( 1.83%) trimmed reads available after processing 3926517 (98.17%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 11 0.00% 20 7 0.00% 21 2 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 5 0.00% 26 8 0.00% 27 10 0.00% 28 14 0.00% 29 22 0.00% 30 17 0.00% 31 31 0.00% 32 53 0.00% 33 40 0.00% 34 38 0.00% 35 33 0.00% 36 44 0.00% 37 71 0.00% 38 86 0.00% 39 64 0.00% 40 125 0.00% 41 139 0.00% 42 177 0.00% 43 230 0.01% 44 305 0.01% 45 484 0.01% 46 597 0.01% 47 889 0.02% 48 1349 0.03% 49 2837 0.07% 50 8079 0.20% 51 57351 1.43% 52 3926517 98.17% 3999651 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.90 fanout-score-rank=33 prefix-density=0.31 prefix-fanout=1.9 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=25.74 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.7 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 13 12:13:46 Started mapping on | Feb 13 12:13:46 Finished on | Feb 13 12:13:51 Mapping speed, Million of reads per hour | 2879.75 Number of input reads | 3999651 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3424163 Uniquely mapped reads % | 85.61% Average mapped length | 51.85 Number of splices: Total | 413026 Number of splices: Annotated (sjdb) | 409282 Number of splices: GT/AG | 406401 Number of splices: GC/AG | 6015 Number of splices: AT/AC | 192 Number of splices: Non-canonical | 418 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 340997 % of reads mapped to multiple loci | 8.53% Number of reads mapped to too many loci | 222753 % of reads mapped to too many loci | 5.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.29% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 234491 234491 234491 N_multimapping 340997 340997 340997 N_noFeature 157807 3387784 169916 N_ambiguous 41624 35 17325 UnstrandedReadsAssigned:3224732 PositiveStrandReadsAssigned:36344 NegativeStrandReadsAssigned:3236922 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423496 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423496-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,651 reads, 3,577,083 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR5423496.ke.tsv 34699 SRR5423496.se.tsv 87100 total ==> SRR5423496.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 46 7.53603 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 2 0.729428 Potri.007G009000.2.v4.1 1416 1317 1 0.238712 Potri.003G141000.2.v4.1 2943 2844 24.1062 2.66476 Potri.016G087400.1.v4.1 270 171 76 139.726 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 2 0.375608 Potri.012G127500.1.v4.1 977 878 105 37.5971 ==> SRR5423496.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 57 Potri.001G212900.v4.1 19 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423496 completed mapping pipeline successfully