Starting /dee2/code/volunteer_pipeline.sh SRR5423497 current disk space = 3093150797824 free memory = 1445669072 SRR5423497 SRAfilesize 76d7fb43bf34ea6a53ce8f82b42a6921 SRR5423497.sra SRR5423497.sra file validated SRR5423497 is single end SRR5423497 is conventional basespace SRR5423497 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423497_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.33125 34.0 31.0 34.0 30.0 34.0 2 32.48375 34.0 31.0 34.0 30.0 34.0 3 32.56275 34.0 31.0 34.0 30.0 34.0 4 36.04475 37.0 35.0 37.0 35.0 37.0 5 36.03375 37.0 35.0 37.0 35.0 37.0 6 36.061 37.0 35.0 37.0 35.0 37.0 7 35.9665 37.0 35.0 37.0 35.0 37.0 8 36.03175 37.0 35.0 37.0 35.0 37.0 9 37.74825 39.0 38.0 39.0 35.0 39.0 10 37.662 39.0 37.0 39.0 35.0 39.0 11 37.6495 39.0 37.0 39.0 35.0 39.0 12 37.771 39.0 38.0 39.0 35.0 39.0 13 37.7045 39.0 37.0 39.0 35.0 39.0 14 39.0375 40.0 38.0 41.0 36.0 41.0 15 39.10875 40.0 39.0 41.0 36.0 41.0 16 39.06175 40.0 38.0 41.0 36.0 41.0 17 39.0295 40.0 38.0 41.0 36.0 41.0 18 38.9365 40.0 38.0 41.0 36.0 41.0 19 39.00525 40.0 39.0 41.0 36.0 41.0 20 38.919 40.0 39.0 41.0 35.0 41.0 21 38.99025 40.0 39.0 41.0 35.0 41.0 22 38.933 40.0 38.0 41.0 35.0 41.0 23 38.91425 40.0 38.0 41.0 35.0 41.0 24 38.90875 40.0 38.0 41.0 35.0 41.0 25 38.9195 40.0 38.0 41.0 35.0 41.0 26 38.844 40.0 38.0 41.0 35.0 41.0 27 38.85475 40.0 38.0 41.0 35.0 41.0 28 38.8595 40.0 38.0 41.0 35.0 41.0 29 38.69725 40.0 38.0 41.0 35.0 41.0 30 38.58275 40.0 38.0 41.0 34.0 41.0 31 38.6545 40.0 38.0 41.0 34.0 41.0 32 38.621 40.0 38.0 41.0 35.0 41.0 33 38.59725 40.0 38.0 41.0 34.0 41.0 34 38.562 40.0 38.0 41.0 34.0 41.0 35 38.63975 40.0 38.0 41.0 34.0 41.0 36 38.51025 40.0 38.0 41.0 34.0 41.0 37 38.3845 40.0 38.0 41.0 34.0 41.0 38 38.36075 40.0 38.0 41.0 34.0 41.0 39 37.85525 40.0 37.0 41.0 33.0 41.0 40 37.92325 40.0 38.0 41.0 33.0 41.0 41 38.116 40.0 38.0 41.0 33.0 41.0 42 38.1235 40.0 38.0 41.0 33.0 41.0 43 37.84175 40.0 37.0 41.0 33.0 41.0 44 37.82775 40.0 37.0 41.0 33.0 41.0 45 37.831 40.0 37.0 41.0 33.0 41.0 46 37.80225 40.0 37.0 41.0 32.0 41.0 47 37.7865 40.0 37.0 41.0 33.0 41.0 48 37.519 40.0 37.0 41.0 32.0 41.0 49 37.55325 40.0 37.0 41.0 32.0 41.0 50 37.3725 40.0 36.0 41.0 31.0 41.0 51 37.224 39.0 36.0 41.0 31.0 41.0 52 35.95975 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1208 1 0.0 1208 2 0.0 1208 3 0.0 1208 4 0.0 1208 5 0.0 1208 6 0.0 1208 7 0.0 1208 8 0.0 1208 9 0.0 1208 10 0.0 1208 11 0.0 1208 12 0.0 1208 13 0.0 1208 14 0.0 1208 15 0.0 1208 16 0.0 1208 17 0.0 1208 18 0.0 1208 19 0.0 1208 20 0.0 1208 21 0.0 1208 22 0.0 1208 23 0.0 1208 24 0.0 1208 25 0.0 1208 26 0.0 1208 27 0.0 1208 28 0.0 1208 29 0.0 1208 30 0.0 1208 31 0.0 1208 32 0.0 1208 33 0.0 1208 34 0.0 1208 35 0.0 1208 36 0.0 1208 37 0.0 1208 38 0.0 1208 39 0.0 1208 40 0.0 1208 41 0.0 1208 42 0.0 1208 43 0.0 1208 44 0.0 1208 45 0.0 1208 46 0.0 1208 47 0.0 1208 48 0.0 1208 49 0.0 1208 50 0.0 1208 51 0.0 1208 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 3.0 23 3.0 24 3.0 25 6.0 26 15.0 27 18.0 28 24.0 29 36.0 30 48.0 31 65.0 32 79.0 33 98.0 34 147.0 35 201.0 36 243.0 37 383.0 38 750.0 39 1869.0 40 7.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.007518796992485 13.684210526315791 6.315789473684211 36.99248120300752 2 22.45 16.675 33.85 27.025 3 19.900000000000002 21.125 26.275 32.7 4 24.95 27.725 22.175 25.15 5 24.075 32.75 22.625 20.549999999999997 6 20.1 32.75 24.15 23.0 7 17.45 21.25 41.0 20.3 8 19.625 21.2 29.849999999999998 29.325000000000003 9 19.525000000000002 19.400000000000002 33.125 27.950000000000003 10 20.599999999999998 35.949999999999996 22.45 21.0 11 25.424999999999997 26.075 19.925 28.575 12 23.825 21.275 25.874999999999996 29.025000000000002 13 22.85 23.95 27.224999999999998 25.974999999999998 14 21.925 25.624999999999996 27.224999999999998 25.224999999999998 15 23.3 24.125 26.525 26.05 16 22.325 25.025 26.625 26.025 17 23.35 25.3 25.25 26.1 18 22.175 25.85 25.7 26.275 19 22.75 25.974999999999998 25.825 25.45 20 22.975 25.275 25.974999999999998 25.775 21 22.95 25.1 25.35 26.6 22 23.775 24.625 24.875 26.724999999999998 23 22.475 26.1 26.125 25.3 24 21.85 24.275 26.25 27.625 25 22.775000000000002 25.35 26.125 25.75 26 23.35 24.6 25.6 26.450000000000003 27 22.975 23.9 26.924999999999997 26.200000000000003 28 23.225 24.45 25.374999999999996 26.950000000000003 29 23.35 24.9 25.974999999999998 25.775 30 22.7 25.724999999999998 25.124999999999996 26.450000000000003 31 23.3 25.874999999999996 24.75 26.075 32 24.125 25.95 25.35 24.575 33 22.075 26.0 25.525 26.400000000000002 34 22.8 25.074999999999996 25.8 26.325 35 23.325000000000003 24.125 26.724999999999998 25.825 36 22.775000000000002 24.375 25.55 27.3 37 24.175 24.15 24.224999999999998 27.450000000000003 38 22.075 24.5 25.974999999999998 27.450000000000003 39 24.099999999999998 24.85 24.349999999999998 26.700000000000003 40 23.25 24.85 25.275 26.625 41 23.25 26.1 24.725 25.924999999999997 42 23.724999999999998 23.575 25.874999999999996 26.825 43 23.599999999999998 23.9 25.775 26.724999999999998 44 21.575 23.575 27.525 27.325 45 23.1 24.25 25.724999999999998 26.924999999999997 46 23.200000000000003 24.775 25.275 26.75 47 22.900000000000002 24.25 25.8 27.05 48 23.05 23.400000000000002 25.874999999999996 27.675 49 22.55 24.6 26.674999999999997 26.174999999999997 50 22.975 23.35 25.75 27.925 51 22.925 24.05 25.25 27.775 52 23.400000000000002 24.725 25.474999999999998 26.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 2.0 18 1.5 19 1.0 20 1.0 21 1.0 22 3.0 23 5.0 24 8.5 25 12.0 26 13.5 27 15.0 28 19.0 29 23.0 30 24.0 31 25.0 32 34.5 33 44.0 34 52.5 35 61.0 36 77.0 37 93.0 38 109.0 39 157.5 40 190.0 41 197.0 42 204.0 43 252.0 44 300.0 45 319.5 46 339.0 47 359.0 48 379.0 49 392.0 50 405.0 51 384.0 52 363.0 53 363.5 54 364.0 55 338.5 56 313.0 57 272.5 58 232.0 59 222.5 60 213.0 61 160.5 62 108.0 63 85.5 64 53.0 65 43.0 66 34.5 67 26.0 68 21.0 69 16.0 70 16.0 71 16.0 72 13.0 73 10.0 74 7.5 75 5.0 76 2.5 77 0.0 78 1.0 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.30150492994292 93.75 2 2.0498183705241306 3.95 3 0.46704722366372603 1.35 4 0.02594706798131811 0.1 5 0.12973533990659056 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02594706798131811 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 9 0.22499999999999998 No Hit GGGAAAGCTGAGGTAGACTTGAGGCCGTTGAATGGTGCAACCATGTTGGCCT 5 0.125 No Hit GTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAAT 5 0.125 No Hit GCCTCCTCAAGCTCAAGCAACACTTGAGATGCCTCAGTGCATCCAAACATGG 5 0.125 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 5 0.125 No Hit CTCTAAGAAGCTGGCCGCGGAGGGTCACCTCCGCATAGCTAGTTAGCAGGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra Read 200000 spots for SRR5423497.sra Written 200000 spots for SRR5423497.sra SRR ids: ['SRR5423497.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ks0paq7c SRR5423497.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423497 file size 703991 SRR5423497 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423497 SRR5423497_1.fastq Input file: SRR5423497_1.fastq trimmed: SRR5423497-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 11:22:34 2025 >> started Thu Feb 13 11:22:35 2025 >> done (1.821s) 4000000 reads processed; of these: 207 ( 0.01%) short reads filtered out after trimming by size control 126 ( 0.00%) empty reads filtered out after trimming by size control 3999667 (99.99%) reads available; of these: 65997 ( 1.65%) trimmed reads available after processing 3933670 (98.35%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 8 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 9 0.00% 27 8 0.00% 28 5 0.00% 29 6 0.00% 30 7 0.00% 31 13 0.00% 32 20 0.00% 33 20 0.00% 34 10 0.00% 35 12 0.00% 36 19 0.00% 37 34 0.00% 38 48 0.00% 39 38 0.00% 40 66 0.00% 41 97 0.00% 42 96 0.00% 43 143 0.00% 44 147 0.00% 45 342 0.01% 46 461 0.01% 47 663 0.02% 48 1153 0.03% 49 2379 0.06% 50 6904 0.17% 51 53276 1.33% 52 3933670 98.35% 3999667 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.90 fanout-score-rank=33 prefix-density=0.31 prefix-fanout=1.9 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=25.07 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.7 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 13 11:22:50 Started mapping on | Feb 13 11:22:50 Finished on | Feb 13 11:22:56 Mapping speed, Million of reads per hour | 2399.80 Number of input reads | 3999667 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3424710 Uniquely mapped reads % | 85.62% Average mapped length | 51.85 Number of splices: Total | 413291 Number of splices: Annotated (sjdb) | 409601 Number of splices: GT/AG | 406489 Number of splices: GC/AG | 6194 Number of splices: AT/AC | 210 Number of splices: Non-canonical | 398 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338962 % of reads mapped to multiple loci | 8.47% Number of reads mapped to too many loci | 225074 % of reads mapped to too many loci | 5.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.27% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 235995 235995 235995 N_multimapping 338962 338962 338962 N_noFeature 157653 3387922 169983 N_ambiguous 41482 18 17013 UnstrandedReadsAssigned:3225575 PositiveStrandReadsAssigned:36770 NegativeStrandReadsAssigned:3237714 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423497 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423497-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,667 reads, 3,577,492 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52401 SRR5423497.ke.tsv 34699 SRR5423497.se.tsv 87100 total ==> SRR5423497.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 44 7.20524 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 32.2747 3.56618 Potri.016G087400.1.v4.1 270 171 73 134.152 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 101 36.1491 ==> SRR5423497.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 55 Potri.001G212900.v4.1 20 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423497 completed mapping pipeline successfully