Starting /dee2/code/volunteer_pipeline.sh SRR5423498 current disk space = 3092465819648 free memory = 1579368268 SRR5423498 SRAfilesize 9d67858954cae866ddc39b4bc21e5596 SRR5423498.sra SRR5423498.sra file validated SRR5423498 is single end SRR5423498 is conventional basespace SRR5423498 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423498_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54025 34.0 31.0 34.0 31.0 34.0 2 32.7255 34.0 31.0 34.0 31.0 34.0 3 32.7705 34.0 31.0 34.0 31.0 34.0 4 36.083 37.0 37.0 37.0 35.0 37.0 5 36.20775 37.0 37.0 37.0 35.0 37.0 6 36.21325 37.0 37.0 37.0 35.0 37.0 7 36.1125 37.0 35.0 37.0 35.0 37.0 8 36.0885 37.0 35.0 37.0 35.0 37.0 9 37.8965 39.0 38.0 39.0 35.0 39.0 10 37.93275 39.0 38.0 39.0 35.0 39.0 11 37.9455 39.0 38.0 39.0 35.0 39.0 12 37.8605 39.0 38.0 39.0 35.0 39.0 13 37.84925 39.0 38.0 39.0 35.0 39.0 14 39.239 41.0 39.0 41.0 36.0 41.0 15 39.23125 40.0 39.0 41.0 36.0 41.0 16 39.2615 41.0 39.0 41.0 36.0 41.0 17 39.211 40.0 39.0 41.0 36.0 41.0 18 39.1095 40.0 38.0 41.0 36.0 41.0 19 39.19825 40.0 39.0 41.0 36.0 41.0 20 39.1385 40.0 39.0 41.0 36.0 41.0 21 39.16225 40.0 39.0 41.0 36.0 41.0 22 39.1545 40.0 39.0 41.0 36.0 41.0 23 38.9695 40.0 39.0 41.0 35.0 41.0 24 38.85775 40.0 38.0 41.0 35.0 41.0 25 39.068 40.0 39.0 41.0 36.0 41.0 26 38.9985 40.0 39.0 41.0 35.0 41.0 27 38.88475 40.0 39.0 41.0 35.0 41.0 28 38.817 40.0 38.0 41.0 35.0 41.0 29 38.75325 40.0 38.0 41.0 35.0 41.0 30 38.75025 40.0 38.0 41.0 35.0 41.0 31 38.7215 40.0 38.0 41.0 35.0 41.0 32 38.73125 40.0 38.0 41.0 35.0 41.0 33 38.68725 40.0 38.0 41.0 34.0 41.0 34 38.56125 40.0 38.0 41.0 34.0 41.0 35 38.597 40.0 38.0 41.0 34.0 41.0 36 38.65825 40.0 38.0 41.0 35.0 41.0 37 38.512 40.0 38.0 41.0 34.0 41.0 38 38.38675 40.0 38.0 41.0 34.0 41.0 39 38.40175 40.0 38.0 41.0 34.0 41.0 40 38.33975 40.0 38.0 41.0 34.0 41.0 41 38.394 40.0 38.0 41.0 34.0 41.0 42 38.228 40.0 38.0 41.0 33.0 41.0 43 38.164 40.0 38.0 41.0 33.0 41.0 44 38.06175 40.0 38.0 41.0 33.0 41.0 45 38.0115 40.0 38.0 41.0 33.0 41.0 46 37.9085 40.0 37.0 41.0 33.0 41.0 47 37.8175 40.0 37.0 41.0 33.0 41.0 48 37.78325 40.0 37.0 41.0 33.0 41.0 49 37.52425 40.0 37.0 41.0 32.0 41.0 50 37.5285 40.0 37.0 41.0 32.0 41.0 51 37.29625 39.0 36.0 41.0 31.0 41.0 52 35.984 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1302 1 0.0 1302 2 0.0 1302 3 0.0 1302 4 0.0 1302 5 0.0 1302 6 0.0 1302 7 0.0 1302 8 0.0 1302 9 0.0 1302 10 0.0 1302 11 0.0 1302 12 0.0 1302 13 0.0 1302 14 0.0 1302 15 0.0 1302 16 0.0 1302 17 0.0 1302 18 0.0 1302 19 0.0 1302 20 0.0 1302 21 0.0 1302 22 0.0 1302 23 0.0 1302 24 0.0 1302 25 0.0 1302 26 0.0 1302 27 0.0 1302 28 0.0 1302 29 0.0 1302 30 0.0 1302 31 0.0 1302 32 0.0 1302 33 0.0 1302 34 0.0 1302 35 0.0 1302 36 0.0 1302 37 0.0 1302 38 0.0 1302 39 0.0 1302 40 0.0 1302 41 0.0 1302 42 0.0 1302 43 0.0 1302 44 0.0 1302 45 0.0 1302 46 0.0 1302 47 0.0 1302 48 0.0 1302 49 0.0 1302 50 0.0 1302 51 0.0 1302 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 3.0 22 4.0 23 3.0 24 4.0 25 9.0 26 9.0 27 15.0 28 20.0 29 32.0 30 44.0 31 57.0 32 73.0 33 88.0 34 121.0 35 154.0 36 254.0 37 376.0 38 704.0 39 2016.0 40 11.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.08963445167752 13.069604406609914 7.085628442663997 36.75513269904857 2 22.75 15.775 34.625 26.85 3 20.474999999999998 21.75 25.974999999999998 31.8 4 24.25 29.825000000000003 21.9 24.025 5 24.85 33.5 21.725 19.925 6 21.25 32.550000000000004 23.150000000000002 23.05 7 16.775000000000002 22.175 40.699999999999996 20.349999999999998 8 19.1 20.25 28.975 31.674999999999997 9 19.025 20.75 32.725 27.500000000000004 10 20.424999999999997 33.85 24.075 21.65 11 26.025 24.5 21.175 28.299999999999997 12 23.974999999999998 23.150000000000002 24.525 28.349999999999998 13 21.75 25.724999999999998 26.174999999999997 26.35 14 22.425 24.75 25.974999999999998 26.85 15 21.65 26.125 25.724999999999998 26.5 16 23.775 24.525 24.875 26.825 17 23.075000000000003 24.8 26.075 26.05 18 22.375 25.474999999999998 25.974999999999998 26.174999999999997 19 22.825 25.6 25.75 25.825 20 24.2 24.85 25.3 25.650000000000002 21 22.375 25.025 25.650000000000002 26.950000000000003 22 22.675 25.525 24.95 26.85 23 22.48062015503876 25.131282820705174 26.356589147286826 26.03150787696924 24 21.75 25.75 26.8 25.7 25 23.65 24.375 25.174999999999997 26.8 26 23.150000000000002 24.775 24.925 27.150000000000002 27 22.725 25.1 25.5 26.674999999999997 28 21.625 25.4 26.450000000000003 26.525 29 22.45 24.675 25.825 27.05 30 20.7 25.85 27.175 26.275 31 22.525000000000002 24.925 26.6 25.95 32 23.200000000000003 22.85 26.375 27.575 33 22.7 24.224999999999998 25.124999999999996 27.950000000000003 34 21.349999999999998 24.7 26.625 27.325 35 23.95 24.25 25.75 26.05 36 22.6 24.675 24.825 27.900000000000002 37 22.55 23.799999999999997 25.25 28.4 38 21.725 24.5 27.3 26.474999999999998 39 23.925 24.075 24.575 27.425 40 22.675 24.925 25.224999999999998 27.175 41 21.85 25.775 25.35 27.025 42 22.475 24.725 25.674999999999997 27.125 43 22.080520130032507 24.081020255063766 26.38159539884971 27.45686421605401 44 22.88072018004501 24.20605151287822 27.35683920980245 25.55638909727432 45 23.625 23.625 26.150000000000002 26.6 46 23.280820205051263 25.406351587896975 24.90622655663916 26.406601650412604 47 25.03125781445361 24.731182795698924 24.90622655663916 25.331332833208304 48 22.680670167541887 24.256064016004 25.756439109777446 27.306826706676667 49 23.625 24.125 25.525 26.724999999999998 50 23.85596399099775 23.55588897224306 26.206551637909474 26.38159539884971 51 21.630407601900476 24.956239059764943 26.156539134783696 27.25681420355089 52 23.730932733183295 24.456114028507127 24.956239059764943 26.85671417854464 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 2.5 19 4.0 20 3.0 21 2.0 22 3.5 23 5.0 24 7.0 25 9.0 26 9.0 27 9.0 28 14.0 29 19.0 30 22.0 31 25.0 32 31.5 33 38.0 34 55.5 35 73.0 36 76.5 37 80.0 38 101.5 39 144.5 40 166.0 41 204.0 42 242.0 43 270.0 44 298.0 45 320.5 46 343.0 47 354.0 48 365.0 49 393.0 50 421.0 51 408.5 52 396.0 53 392.5 54 389.0 55 343.5 56 298.0 57 265.5 58 233.0 59 210.0 60 187.0 61 141.5 62 96.0 63 81.5 64 53.0 65 39.0 66 31.0 67 23.0 68 19.5 69 16.0 70 12.5 71 9.0 72 10.0 73 11.0 74 9.0 75 7.0 76 5.0 77 3.0 78 2.5 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.025 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.025 44 0.025 45 0.0 46 0.025 47 0.025 48 0.025 49 0.0 50 0.025 51 0.025 52 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.075 #Duplication Level Percentage of deduplicated Percentage of total 1 97.50193149626577 94.65 2 2.189029101210404 4.25 3 0.18027298480556272 0.525 4 0.10301313417460728 0.4 5 0.0 0.0 6 0.0 0.0 7 0.02575328354365182 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra Read 200000 spots for SRR5423498.sra Written 200000 spots for SRR5423498.sra SRR ids: ['SRR5423498.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ht7dbqcc SRR5423498.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423498 file size 703966 SRR5423498 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423498 SRR5423498_1.fastq Input file: SRR5423498_1.fastq trimmed: SRR5423498-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:15:25 2025 >> started Thu Feb 13 12:15:27 2025 >> done (1.954s) 4000000 reads processed; of these: 202 ( 0.01%) short reads filtered out after trimming by size control 111 ( 0.00%) empty reads filtered out after trimming by size control 3999687 (99.99%) reads available; of these: 60125 ( 1.50%) trimmed reads available after processing 3939562 (98.50%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 4 0.00% 20 5 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 3 0.00% 27 5 0.00% 28 5 0.00% 29 7 0.00% 30 8 0.00% 31 12 0.00% 32 14 0.00% 33 11 0.00% 34 17 0.00% 35 15 0.00% 36 22 0.00% 37 48 0.00% 38 41 0.00% 39 43 0.00% 40 70 0.00% 41 104 0.00% 42 81 0.00% 43 133 0.00% 44 176 0.00% 45 351 0.01% 46 551 0.01% 47 670 0.02% 48 1010 0.03% 49 2166 0.05% 50 6366 0.16% 51 48177 1.20% 52 3939562 98.50% 3999687 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=33 prefix-density=0.32 prefix-fanout=1.9 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=20.25 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.8 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 13 12:15:40 Started mapping on | Feb 13 12:15:40 Finished on | Feb 13 12:15:45 Mapping speed, Million of reads per hour | 2879.77 Number of input reads | 3999687 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3422999 Uniquely mapped reads % | 85.58% Average mapped length | 51.85 Number of splices: Total | 412991 Number of splices: Annotated (sjdb) | 409227 Number of splices: GT/AG | 406454 Number of splices: GC/AG | 6018 Number of splices: AT/AC | 180 Number of splices: Non-canonical | 339 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 340421 % of reads mapped to multiple loci | 8.51% Number of reads mapped to too many loci | 225185 % of reads mapped to too many loci | 5.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.27% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 236267 236267 236267 N_multimapping 340421 340421 340421 N_noFeature 158400 3386642 170720 N_ambiguous 41152 25 17105 UnstrandedReadsAssigned:3223447 PositiveStrandReadsAssigned:36332 NegativeStrandReadsAssigned:3235174 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423498 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423498-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,687 reads, 3,578,149 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR5423498.ke.tsv 34699 SRR5423498.se.tsv 87100 total ==> SRR5423498.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 55 8.99942 Potri.005G024800.1.v4.1 1035 936 2 0.670936 Potri.004G059700.1.v4.1 961 862 7 2.54987 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 33.5721 3.7066 Potri.016G087400.1.v4.1 270 171 74 135.882 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 98 35.0476 ==> SRR5423498.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 60 Potri.001G212900.v4.1 26 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423498 completed mapping pipeline successfully