Starting /dee2/code/volunteer_pipeline.sh SRR5423499 current disk space = 3092974383104 free memory = 1460337400 SRR5423499 SRAfilesize 41735ea2c31eb434f0750a5d22076b94 SRR5423499.sra SRR5423499.sra file validated SRR5423499 is single end SRR5423499 is conventional basespace SRR5423499 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423499_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0915 31.0 30.0 34.0 28.0 34.0 2 31.53825 31.0 31.0 34.0 28.0 34.0 3 31.83625 31.0 31.0 34.0 30.0 34.0 4 31.253 35.0 30.0 37.0 19.0 37.0 5 33.9405 35.0 33.0 37.0 28.0 37.0 6 34.92 35.0 35.0 37.0 32.0 37.0 7 35.3525 37.0 35.0 37.0 33.0 37.0 8 35.434 37.0 35.0 37.0 33.0 37.0 9 37.1675 39.0 37.0 39.0 33.0 39.0 10 37.19775 39.0 37.0 39.0 33.0 39.0 11 37.34775 39.0 37.0 39.0 34.0 39.0 12 37.3655 39.0 37.0 39.0 34.0 39.0 13 37.10625 39.0 37.0 39.0 33.0 39.0 14 38.384 40.0 38.0 41.0 34.0 41.0 15 38.49525 40.0 38.0 41.0 34.0 41.0 16 38.5335 40.0 38.0 41.0 34.0 41.0 17 38.51025 40.0 38.0 41.0 34.0 41.0 18 38.278 40.0 38.0 41.0 33.0 41.0 19 38.31375 40.0 38.0 41.0 34.0 41.0 20 38.2955 40.0 38.0 41.0 34.0 41.0 21 38.31475 40.0 38.0 41.0 33.0 41.0 22 38.44225 40.0 38.0 41.0 34.0 41.0 23 38.4525 40.0 38.0 41.0 34.0 41.0 24 38.30025 40.0 38.0 41.0 34.0 41.0 25 38.456 40.0 38.0 41.0 34.0 41.0 26 38.29175 40.0 38.0 41.0 34.0 41.0 27 38.40925 40.0 38.0 41.0 34.0 41.0 28 38.316 40.0 38.0 41.0 34.0 41.0 29 37.9865 40.0 37.0 41.0 33.0 41.0 30 38.11075 40.0 37.0 41.0 33.0 41.0 31 38.11425 40.0 38.0 41.0 33.0 41.0 32 38.144 40.0 37.0 41.0 33.0 41.0 33 38.08425 40.0 37.0 41.0 33.0 41.0 34 38.05975 40.0 38.0 41.0 33.0 41.0 35 37.84675 40.0 37.0 41.0 33.0 41.0 36 37.6785 40.0 37.0 41.0 32.0 41.0 37 37.6645 40.0 37.0 41.0 33.0 41.0 38 37.80325 40.0 37.0 41.0 33.0 41.0 39 37.6575 40.0 37.0 41.0 32.0 41.0 40 37.7915 40.0 37.0 41.0 33.0 41.0 41 37.5085 40.0 37.0 41.0 32.0 41.0 42 37.5115 40.0 37.0 41.0 31.0 41.0 43 37.4775 40.0 37.0 41.0 31.0 41.0 44 37.565 40.0 37.0 41.0 32.0 41.0 45 37.3235 39.0 36.0 41.0 31.0 41.0 46 37.44625 40.0 36.0 41.0 32.0 41.0 47 37.32875 39.0 36.0 41.0 31.0 41.0 48 37.30425 39.0 36.0 41.0 31.0 41.0 49 37.198 39.0 36.0 41.0 31.0 41.0 50 37.13475 39.0 36.0 41.0 31.0 41.0 51 37.17975 39.0 36.0 41.0 31.0 41.0 52 35.847 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1313 1 0.0 1313 2 0.0 1313 3 0.0 1313 4 0.0 1313 5 0.0 1313 6 0.0 1313 7 0.0 1313 8 0.0 1313 9 0.0 1313 10 0.0 1313 11 0.0 1313 12 0.0 1313 13 0.0 1313 14 0.0 1313 15 0.0 1313 16 0.0 1313 17 0.0 1313 18 0.0 1313 19 0.0 1313 20 0.0 1313 21 0.0 1313 22 0.0 1313 23 0.0 1313 24 0.0 1313 25 0.0 1313 26 0.0 1313 27 0.0 1313 28 0.0 1313 29 0.0 1313 30 0.0 1313 31 0.0 1313 32 0.0 1313 33 0.0 1313 34 0.0 1313 35 0.0 1313 36 0.0 1313 37 0.0 1313 38 0.0 1313 39 0.0 1313 40 0.0 1313 41 0.0 1313 42 0.0 1313 43 0.0 1313 44 0.0 1313 45 0.0 1313 46 0.0 1313 47 0.0 1313 48 0.0 1313 49 0.0 1313 50 0.0 1313 51 0.0 1313 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 3.0 23 4.0 24 4.0 25 12.0 26 13.0 27 23.0 28 26.0 29 57.0 30 67.0 31 104.0 32 125.0 33 135.0 34 181.0 35 262.0 36 389.0 37 479.0 38 792.0 39 1317.0 40 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.28857715430862 12.850701402805612 7.18937875751503 35.671342685370746 2 23.375 17.05 34.475 25.1 3 21.475 22.25 25.2 31.075000000000003 4 24.6 28.050000000000004 24.375 22.975 5 23.200000000000003 33.375 22.85 20.575 6 19.950000000000003 33.85 23.65 22.55 7 17.2 20.674999999999997 41.6 20.525 8 19.025 19.325 30.725 30.925000000000004 9 19.075 19.8 33.15 27.975 10 21.099999999999998 34.75 23.7 20.45 11 25.95 24.275 21.525 28.249999999999996 12 23.549999999999997 20.724999999999998 24.875 30.85 13 21.475 25.2 27.900000000000002 25.424999999999997 14 20.925 24.775 27.725 26.575 15 21.075 24.6 27.025 27.3 16 22.6 26.55 26.025 24.825 17 23.075000000000003 23.799999999999997 26.625 26.5 18 20.599999999999998 23.95 27.900000000000002 27.55 19 22.525000000000002 24.95 27.0 25.525 20 23.674999999999997 25.35 25.525 25.45 21 22.5 24.425 27.275 25.8 22 23.674999999999997 24.25 24.825 27.250000000000004 23 23.63090772693173 23.830957739434858 25.95648912228057 26.581645411352838 24 21.3 25.424999999999997 26.775 26.5 25 22.2 25.8 24.975 27.025 26 22.475 24.875 26.55 26.1 27 22.175 25.474999999999998 25.25 27.1 28 23.325000000000003 24.525 25.5 26.650000000000002 29 23.875 24.75 26.075 25.3 30 22.175 24.775 26.650000000000002 26.400000000000002 31 23.075000000000003 25.45 24.925 26.55 32 23.65 23.45 25.674999999999997 27.224999999999998 33 22.775000000000002 23.799999999999997 26.924999999999997 26.5 34 23.05 24.3 25.174999999999997 27.474999999999998 35 23.325000000000003 25.124999999999996 25.474999999999998 26.075 36 23.125 25.0 26.525 25.35 37 23.875 23.775 25.05 27.3 38 23.1 23.7 26.200000000000003 27.0 39 23.724999999999998 23.775 25.275 27.224999999999998 40 24.325 24.375 24.8 26.5 41 24.25 23.7 25.124999999999996 26.924999999999997 42 23.1 23.5 27.0 26.400000000000002 43 23.35 24.5 26.6 25.55 44 23.599999999999998 23.9 25.924999999999997 26.575 45 22.35 25.4 25.5 26.75 46 24.65 23.575 24.45 27.325 47 23.799999999999997 24.099999999999998 26.075 26.025 48 22.930732683170792 23.730932733183295 26.38159539884971 26.9567391847962 49 23.025000000000002 24.099999999999998 25.474999999999998 27.400000000000002 50 22.73068267066767 25.93148287071768 26.806701675418854 24.5311327831958 51 23.330832708177045 23.55588897224306 26.70667666916729 26.406601650412604 52 23.625 24.05 24.825 27.500000000000004 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.5 19 3.0 20 2.5 21 2.0 22 4.0 23 6.0 24 8.0 25 10.0 26 9.5 27 9.0 28 14.5 29 20.0 30 19.5 31 19.0 32 36.0 33 53.0 34 57.0 35 61.0 36 81.0 37 101.0 38 115.0 39 154.0 40 179.0 41 209.5 42 240.0 43 256.5 44 273.0 45 307.0 46 341.0 47 361.5 48 382.0 49 394.0 50 406.0 51 391.5 52 377.0 53 379.5 54 382.0 55 342.5 56 303.0 57 278.0 58 253.0 59 205.5 60 158.0 61 129.0 62 100.0 63 86.0 64 57.0 65 42.0 66 37.0 67 32.0 68 24.0 69 16.0 70 11.5 71 7.0 72 8.0 73 9.0 74 8.0 75 7.0 76 4.5 77 2.0 78 2.5 79 3.0 80 1.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.025 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.025 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.925 #Duplication Level Percentage of deduplicated Percentage of total 1 97.6012380706732 94.6 2 1.8313128707763735 3.55 3 0.41269022440030956 1.2 4 0.10317255610007739 0.4 5 0.051586278050038695 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCGACTCCGGTCACGAGACCTTGCACAAAGTAACCCAAGATGGCCAACAT 5 0.125 No Hit GGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra Read 200000 spots for SRR5423499.sra Written 200000 spots for SRR5423499.sra SRR ids: ['SRR5423499.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lm3baiw1 SRR5423499.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423499 file size 703972 SRR5423499 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423499 SRR5423499_1.fastq Input file: SRR5423499_1.fastq trimmed: SRR5423499-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 11:54:36 2025 >> started Thu Feb 13 11:54:37 2025 >> done (1.883s) 4000000 reads processed; of these: 206 ( 0.01%) short reads filtered out after trimming by size control 143 ( 0.00%) empty reads filtered out after trimming by size control 3999651 (99.99%) reads available; of these: 61560 ( 1.54%) trimmed reads available after processing 3938091 (98.46%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 4 0.00% 21 0 0.00% 22 2 0.00% 23 0 0.00% 24 3 0.00% 25 6 0.00% 26 4 0.00% 27 5 0.00% 28 9 0.00% 29 6 0.00% 30 8 0.00% 31 20 0.00% 32 24 0.00% 33 24 0.00% 34 25 0.00% 35 31 0.00% 36 39 0.00% 37 51 0.00% 38 60 0.00% 39 43 0.00% 40 93 0.00% 41 128 0.00% 42 132 0.00% 43 162 0.00% 44 230 0.01% 45 422 0.01% 46 619 0.02% 47 775 0.02% 48 1279 0.03% 49 2470 0.06% 50 6821 0.17% 51 48050 1.20% 52 3938091 98.46% 3999651 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=32 prefix-density=0.21 prefix-fanout=2.0 sequence=CTACCATTCTTGAGTTCCTTCACCTTCAACTCAGCGAATGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=21.64 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.8 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 13 11:54:47 Started mapping on | Feb 13 11:54:47 Finished on | Feb 13 11:54:52 Mapping speed, Million of reads per hour | 2879.75 Number of input reads | 3999651 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3423639 Uniquely mapped reads % | 85.60% Average mapped length | 51.85 Number of splices: Total | 412598 Number of splices: Annotated (sjdb) | 408899 Number of splices: GT/AG | 406024 Number of splices: GC/AG | 5976 Number of splices: AT/AC | 193 Number of splices: Non-canonical | 405 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 340507 % of reads mapped to multiple loci | 8.51% Number of reads mapped to too many loci | 224060 % of reads mapped to too many loci | 5.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.28% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 235505 235505 235505 N_multimapping 340507 340507 340507 N_noFeature 157901 3386753 170282 N_ambiguous 41506 33 16987 UnstrandedReadsAssigned:3224232 PositiveStrandReadsAssigned:36853 NegativeStrandReadsAssigned:3236370 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423499 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423499-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,651 reads, 3,576,820 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR5423499.ke.tsv 34699 SRR5423499.se.tsv 87100 total ==> SRR5423499.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 43 7.03901 Potri.005G024800.1.v4.1 1035 936 0 0 Potri.004G059700.1.v4.1 961 862 3 1.09328 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 31.138 3.43938 Potri.016G087400.1.v4.1 270 171 68 124.92 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 85 30.4118 ==> SRR5423499.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 59 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423499 completed mapping pipeline successfully