Starting /dee2/code/volunteer_pipeline.sh SRR5423500 current disk space = 3093398257664 free memory = 1312701640 SRR5423500 SRAfilesize 1f4852a9958c86c799c4fa7cc3d9129d SRR5423500.sra SRR5423500.sra file validated SRR5423500 is single end SRR5423500 is conventional basespace SRR5423500 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423500_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.37125 34.0 31.0 34.0 30.0 34.0 2 32.45475 34.0 31.0 34.0 30.0 34.0 3 32.53375 34.0 31.0 34.0 30.0 34.0 4 35.444 37.0 35.0 37.0 33.0 37.0 5 35.9385 37.0 35.0 37.0 35.0 37.0 6 36.009 37.0 35.0 37.0 35.0 37.0 7 36.0365 37.0 35.0 37.0 35.0 37.0 8 36.04775 37.0 35.0 37.0 35.0 37.0 9 37.762 39.0 38.0 39.0 35.0 39.0 10 37.6115 39.0 37.0 39.0 35.0 39.0 11 37.70775 39.0 37.0 39.0 35.0 39.0 12 37.65675 39.0 37.0 39.0 35.0 39.0 13 37.59375 39.0 37.0 39.0 35.0 39.0 14 38.944 40.0 38.0 41.0 36.0 41.0 15 39.0235 40.0 38.0 41.0 36.0 41.0 16 38.90925 40.0 38.0 41.0 35.0 41.0 17 39.0195 40.0 38.0 41.0 36.0 41.0 18 39.014 40.0 38.0 41.0 36.0 41.0 19 38.96825 40.0 38.0 41.0 35.0 41.0 20 38.86525 40.0 38.0 41.0 35.0 41.0 21 39.0495 40.0 39.0 41.0 36.0 41.0 22 39.034 40.0 39.0 41.0 36.0 41.0 23 39.03375 40.0 39.0 41.0 36.0 41.0 24 38.9725 40.0 39.0 41.0 35.0 41.0 25 38.928 40.0 38.0 41.0 35.0 41.0 26 38.8575 40.0 38.0 41.0 35.0 41.0 27 38.8305 40.0 38.0 41.0 35.0 41.0 28 38.7195 40.0 38.0 41.0 35.0 41.0 29 38.754 40.0 38.0 41.0 35.0 41.0 30 38.83475 40.0 38.0 41.0 35.0 41.0 31 38.71425 40.0 38.0 41.0 34.0 41.0 32 38.708 40.0 38.0 41.0 35.0 41.0 33 38.7335 40.0 38.0 41.0 35.0 41.0 34 38.68575 40.0 38.0 41.0 35.0 41.0 35 38.532 40.0 38.0 41.0 34.0 41.0 36 38.62825 40.0 38.0 41.0 34.0 41.0 37 38.44325 40.0 38.0 41.0 34.0 41.0 38 38.254 40.0 38.0 41.0 33.0 41.0 39 38.25825 40.0 38.0 41.0 33.0 41.0 40 38.3105 40.0 38.0 41.0 33.0 41.0 41 38.343 40.0 38.0 41.0 33.0 41.0 42 38.19025 40.0 38.0 41.0 33.0 41.0 43 38.105 40.0 38.0 41.0 33.0 41.0 44 38.00225 40.0 37.0 41.0 33.0 41.0 45 37.95025 40.0 37.0 41.0 33.0 41.0 46 38.05 40.0 37.0 41.0 33.0 41.0 47 37.76975 40.0 37.0 41.0 33.0 41.0 48 37.74675 40.0 37.0 41.0 32.0 41.0 49 37.80475 40.0 37.0 41.0 33.0 41.0 50 37.565 40.0 37.0 41.0 32.0 41.0 51 37.43725 40.0 36.0 41.0 31.0 41.0 52 36.719 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2109 1 0.0 2109 2 0.0 2109 3 0.0 2109 4 0.0 2109 5 0.0 2109 6 0.0 2109 7 0.0 2109 8 0.0 2109 9 0.0 2109 10 0.0 2109 11 0.0 2109 12 0.0 2109 13 0.0 2109 14 0.0 2109 15 0.0 2109 16 0.0 2109 17 0.0 2109 18 0.0 2109 19 0.0 2109 20 0.0 2109 21 0.0 2109 22 0.0 2109 23 0.0 2109 24 0.0 2109 25 0.0 2109 26 0.0 2109 27 0.0 2109 28 0.0 2109 29 0.0 2109 30 0.0 2109 31 0.0 2109 32 0.0 2109 33 0.0 2109 34 0.0 2109 35 0.0 2109 36 0.0 2109 37 0.0 2109 38 0.0 2109 39 0.0 2109 40 0.0 2109 41 0.0 2109 42 0.0 2109 43 0.0 2109 44 0.0 2109 45 0.0 2109 46 0.0 2109 47 0.0 2109 48 0.0 2109 49 0.0 2109 50 0.0 2109 51 0.0 2109 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 1.0 23 3.0 24 4.0 25 5.0 26 9.0 27 13.0 28 18.0 29 41.0 30 44.0 31 58.0 32 93.0 33 93.0 34 140.0 35 174.0 36 271.0 37 407.0 38 708.0 39 1906.0 40 9.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.97997496871089 12.866082603254068 6.758448060075094 36.395494367959955 2 22.7 17.549999999999997 34.425 25.324999999999996 3 20.200000000000003 21.125 26.25 32.425 4 23.75 29.675 23.025000000000002 23.549999999999997 5 24.25 32.324999999999996 22.875 20.549999999999997 6 20.45 32.125 22.925 24.5 7 17.075000000000003 22.15 40.425 20.349999999999998 8 18.425 20.25 30.599999999999998 30.725 9 20.5 19.45 31.624999999999996 28.425 10 20.875 36.275 23.3 19.55 11 25.55 25.424999999999997 20.3 28.725 12 22.575 21.875 25.900000000000002 29.65 13 20.175 25.724999999999998 27.6 26.5 14 21.525 24.9 27.625 25.95 15 22.650000000000002 23.925 25.900000000000002 27.525 16 21.3 25.474999999999998 26.375 26.85 17 22.55 25.924999999999997 25.874999999999996 25.650000000000002 18 21.675 24.025 26.275 28.025 19 22.15 25.85 25.224999999999998 26.775 20 23.525 25.074999999999996 25.5 25.900000000000002 21 22.650000000000002 23.724999999999998 26.325 27.3 22 23.65 24.349999999999998 26.150000000000002 25.85 23 22.225 25.825 26.825 25.124999999999996 24 22.925 24.95 25.5 26.625 25 23.674999999999997 25.025 25.025 26.275 26 23.375 24.625 24.75 27.250000000000004 27 22.225 25.15 25.474999999999998 27.150000000000002 28 23.75 24.975 25.074999999999996 26.200000000000003 29 22.05 26.075 25.900000000000002 25.974999999999998 30 22.2 23.875 26.35 27.575 31 22.175 25.324999999999996 25.6 26.900000000000002 32 22.650000000000002 24.75 27.224999999999998 25.374999999999996 33 21.375 23.625 27.125 27.875 34 22.625 23.95 26.75 26.674999999999997 35 21.65 25.324999999999996 26.3 26.724999999999998 36 22.325 24.375 26.150000000000002 27.150000000000002 37 23.150000000000002 24.8 25.1 26.950000000000003 38 22.7 23.974999999999998 26.125 27.200000000000003 39 22.075 24.9 24.925 28.1 40 22.900000000000002 24.725 25.2 27.175 41 22.5 25.825 26.525 25.15 42 22.975 23.0 26.5 27.525 43 22.675 25.55 24.425 27.35 44 22.75 24.65 26.875 25.724999999999998 45 22.900000000000002 24.474999999999998 26.35 26.275 46 23.3 25.0 26.400000000000002 25.3 47 23.45 25.825 25.7 25.025 48 23.305826456614152 22.780695173793447 25.831457864466117 28.08202050512628 49 22.650000000000002 24.55 25.3 27.500000000000004 50 22.875 23.425 27.175 26.525 51 23.325000000000003 22.900000000000002 25.374999999999996 28.4 52 23.849999999999998 25.7 24.425 26.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 2.5 23 4.0 24 7.0 25 10.0 26 12.0 27 14.0 28 15.5 29 17.0 30 21.5 31 26.0 32 37.0 33 48.0 34 57.0 35 66.0 36 86.5 37 107.0 38 122.5 39 158.0 40 178.0 41 191.0 42 204.0 43 249.0 44 294.0 45 336.0 46 378.0 47 376.5 48 375.0 49 384.5 50 394.0 51 372.5 52 351.0 53 374.0 54 397.0 55 359.5 56 322.0 57 271.5 58 221.0 59 189.0 60 157.0 61 145.0 62 133.0 63 93.5 64 46.5 65 39.0 66 31.5 67 24.0 68 21.0 69 18.0 70 13.5 71 9.0 72 10.0 73 11.0 74 9.0 75 7.0 76 4.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.1 #Duplication Level Percentage of deduplicated Percentage of total 1 97.57981462409887 94.75 2 2.033985581874356 3.95 3 0.33470648815653964 0.975 4 0.0 0.0 5 0.0 0.0 6 0.025746652935118432 0.15 7 0.025746652935118432 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 7 0.17500000000000002 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra Read 200000 spots for SRR5423500.sra Written 200000 spots for SRR5423500.sra SRR ids: ['SRR5423500.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2unfkl3z SRR5423500.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423500 file size 703995 SRR5423500 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423500 SRR5423500_1.fastq Input file: SRR5423500_1.fastq trimmed: SRR5423500-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 11:31:02 2025 >> started Thu Feb 13 11:31:04 2025 >> done (2.002s) 4000000 reads processed; of these: 233 ( 0.01%) short reads filtered out after trimming by size control 130 ( 0.00%) empty reads filtered out after trimming by size control 3999637 (99.99%) reads available; of these: 64203 ( 1.61%) trimmed reads available after processing 3935434 (98.39%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 6 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 2 0.00% 25 7 0.00% 26 8 0.00% 27 12 0.00% 28 14 0.00% 29 18 0.00% 30 12 0.00% 31 16 0.00% 32 37 0.00% 33 40 0.00% 34 26 0.00% 35 26 0.00% 36 34 0.00% 37 47 0.00% 38 48 0.00% 39 65 0.00% 40 69 0.00% 41 109 0.00% 42 145 0.00% 43 171 0.00% 44 250 0.01% 45 344 0.01% 46 542 0.01% 47 782 0.02% 48 1372 0.03% 49 2619 0.07% 50 7347 0.18% 51 50016 1.25% 52 3935434 98.39% 3999637 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.90 fanout-score-rank=34 prefix-density=0.31 prefix-fanout=1.9 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=29.93 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 13 11:31:18 Started mapping on | Feb 13 11:31:19 Finished on | Feb 13 11:31:23 Mapping speed, Million of reads per hour | 3599.67 Number of input reads | 3999637 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3423635 Uniquely mapped reads % | 85.60% Average mapped length | 51.84 Number of splices: Total | 412447 Number of splices: Annotated (sjdb) | 408747 Number of splices: GT/AG | 405779 Number of splices: GC/AG | 6112 Number of splices: AT/AC | 187 Number of splices: Non-canonical | 369 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 340592 % of reads mapped to multiple loci | 8.52% Number of reads mapped to too many loci | 223620 % of reads mapped to too many loci | 5.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.29% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 235410 235410 235410 N_multimapping 340592 340592 340592 N_noFeature 157234 3386869 169575 N_ambiguous 41603 28 17162 UnstrandedReadsAssigned:3224798 PositiveStrandReadsAssigned:36738 NegativeStrandReadsAssigned:3236898 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423500 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423500-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,637 reads, 3,564,851 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR5423500.ke.tsv 34699 SRR5423500.se.tsv 87100 total ==> SRR5423500.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 50 8.21475 Potri.005G024800.1.v4.1 1035 936 1.00095 0.337161 Potri.004G059700.1.v4.1 961 862 3 1.09727 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 29.415 3.26091 Potri.016G087400.1.v4.1 270 171 74 136.438 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 114 40.9364 ==> SRR5423500.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 44 Potri.001G212900.v4.1 25 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423500 completed mapping pipeline successfully