Starting /dee2/code/volunteer_pipeline.sh SRR5423501 current disk space = 3093146103808 free memory = 1485054952 SRR5423501 SRAfilesize 2a57c7663aaae3fa53e3ae00f274ce70 SRR5423501.sra SRR5423501.sra file validated SRR5423501 is single end SRR5423501 is conventional basespace SRR5423501 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423501_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.66825 34.0 31.0 34.0 31.0 34.0 2 32.78375 34.0 31.0 34.0 31.0 34.0 3 32.8035 34.0 31.0 34.0 31.0 34.0 4 36.14175 37.0 37.0 37.0 35.0 37.0 5 36.1645 37.0 37.0 37.0 35.0 37.0 6 36.0525 37.0 36.0 37.0 35.0 37.0 7 36.1615 37.0 35.0 37.0 35.0 37.0 8 36.1725 37.0 36.0 37.0 35.0 37.0 9 37.884 39.0 38.0 39.0 35.0 39.0 10 37.91175 39.0 38.0 39.0 35.0 39.0 11 37.909 39.0 38.0 39.0 35.0 39.0 12 37.84075 39.0 38.0 39.0 35.0 39.0 13 37.80225 39.0 38.0 39.0 35.0 39.0 14 39.21825 41.0 39.0 41.0 36.0 41.0 15 39.32275 41.0 39.0 41.0 36.0 41.0 16 39.2955 40.0 39.0 41.0 36.0 41.0 17 39.27575 40.0 39.0 41.0 36.0 41.0 18 39.21475 40.0 39.0 41.0 36.0 41.0 19 39.1635 40.0 39.0 41.0 36.0 41.0 20 39.16875 40.0 39.0 41.0 36.0 41.0 21 39.21 40.0 39.0 41.0 36.0 41.0 22 39.15575 40.0 39.0 41.0 36.0 41.0 23 39.1265 40.0 39.0 41.0 36.0 41.0 24 39.199 40.0 39.0 41.0 36.0 41.0 25 39.18125 40.0 39.0 41.0 36.0 41.0 26 39.08675 40.0 39.0 41.0 36.0 41.0 27 38.95475 40.0 39.0 41.0 35.0 41.0 28 38.91825 40.0 39.0 41.0 35.0 41.0 29 38.89325 40.0 38.0 41.0 35.0 41.0 30 38.81925 40.0 38.0 41.0 35.0 41.0 31 38.83125 40.0 38.0 41.0 35.0 41.0 32 38.8055 40.0 38.0 41.0 35.0 41.0 33 38.7195 40.0 38.0 41.0 35.0 41.0 34 38.6155 40.0 38.0 41.0 35.0 41.0 35 38.518 40.0 38.0 41.0 34.0 41.0 36 38.58175 40.0 38.0 41.0 35.0 41.0 37 38.49475 40.0 38.0 41.0 34.0 41.0 38 38.22025 40.0 38.0 41.0 34.0 41.0 39 38.248 40.0 38.0 41.0 34.0 41.0 40 38.1715 40.0 38.0 41.0 33.0 41.0 41 38.01925 40.0 38.0 41.0 33.0 41.0 42 38.07225 40.0 38.0 41.0 33.0 41.0 43 38.051 40.0 38.0 41.0 33.0 41.0 44 37.691 40.0 37.0 41.0 33.0 41.0 45 37.75575 40.0 37.0 41.0 33.0 41.0 46 37.57025 40.0 37.0 41.0 32.0 41.0 47 37.55 40.0 37.0 41.0 32.0 41.0 48 37.56975 40.0 37.0 41.0 32.0 41.0 49 37.63675 40.0 37.0 41.0 32.0 41.0 50 37.61725 40.0 37.0 41.0 32.0 41.0 51 37.459 40.0 36.0 41.0 31.0 41.0 52 36.18975 38.0 35.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2204 1 0.0 2204 2 0.0 2204 3 0.0 2204 4 0.0 2204 5 0.0 2204 6 0.0 2204 7 0.0 2204 8 0.0 2204 9 0.0 2204 10 0.0 2204 11 0.0 2204 12 0.0 2204 13 0.0 2204 14 0.0 2204 15 0.0 2204 16 0.0 2204 17 0.0 2204 18 0.0 2204 19 0.0 2204 20 0.0 2204 21 0.0 2204 22 0.0 2204 23 0.0 2204 24 0.0 2204 25 0.0 2204 26 0.0 2204 27 0.0 2204 28 0.0 2204 29 0.0 2204 30 0.0 2204 31 0.0 2204 32 0.0 2204 33 0.0 2204 34 0.0 2204 35 0.0 2204 36 0.0 2204 37 0.0 2204 38 0.0 2204 39 0.0 2204 40 0.0 2204 41 0.0 2204 42 0.0 2204 43 0.0 2204 44 0.0 2204 45 0.0 2204 46 0.0 2204 47 0.0 2204 48 0.0 2204 49 0.0 2204 50 0.0 2204 51 0.0 2204 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.0 23 3.0 24 6.0 25 11.0 26 12.0 27 22.0 28 29.0 29 27.0 30 40.0 31 48.0 32 66.0 33 104.0 34 125.0 35 137.0 36 245.0 37 388.0 38 701.0 39 2023.0 40 8.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.608456342256694 12.884663497623217 6.805103827870903 35.70177633224919 2 23.25 16.150000000000002 35.225 25.374999999999996 3 20.275000000000002 21.15 27.0 31.574999999999996 4 24.775 28.1 21.675 25.45 5 23.25 34.025 22.6 20.125 6 21.525 31.75 23.150000000000002 23.575 7 16.625 21.975 40.35 21.05 8 18.95 20.7 29.875 30.475 9 18.375 20.25 31.825 29.549999999999997 10 20.3 35.3 22.675 21.725 11 25.525 24.75 20.175 29.549999999999997 12 23.849999999999998 19.900000000000002 26.174999999999997 30.075000000000003 13 21.475 24.925 26.974999999999998 26.625 14 21.55 26.0 28.125 24.325 15 23.625 24.45 25.15 26.775 16 23.075000000000003 24.75 26.25 25.924999999999997 17 22.625 24.825 27.125 25.424999999999997 18 22.45 24.125 25.924999999999997 27.500000000000004 19 22.575 25.900000000000002 25.45 26.075 20 22.375 27.525 25.4 24.7 21 22.875 23.925 26.474999999999998 26.724999999999998 22 22.525000000000002 25.124999999999996 25.025 27.325 23 23.1 26.200000000000003 25.924999999999997 24.775 24 21.9 24.675 26.650000000000002 26.775 25 23.225 25.374999999999996 25.85 25.55 26 23.375 24.65 25.374999999999996 26.6 27 22.075 25.174999999999997 25.7 27.05 28 23.425 24.6 25.7 26.275 29 23.200000000000003 24.4 25.7 26.700000000000003 30 22.650000000000002 24.4 25.85 27.1 31 22.75 26.525 25.3 25.424999999999997 32 23.125 25.45 24.725 26.700000000000003 33 22.35 24.175 26.1 27.375 34 22.725 25.775 25.825 25.674999999999997 35 22.525000000000002 24.45 25.75 27.275 36 22.6 23.875 25.05 28.475 37 23.0 24.45 24.925 27.625 38 21.85 25.424999999999997 25.900000000000002 26.825 39 22.85 24.325 25.6 27.224999999999998 40 23.425 24.075 25.05 27.450000000000003 41 23.075000000000003 25.650000000000002 24.65 26.625 42 22.55 25.55 25.525 26.375 43 23.425 24.175 25.4 27.0 44 22.475 24.825 27.800000000000004 24.9 45 23.25 23.974999999999998 25.05 27.725 46 24.937468734367183 24.462231115557778 25.162581290645324 25.437718859429715 47 22.8 25.624999999999996 26.150000000000002 25.424999999999997 48 23.43085771442861 23.455863965991497 25.531382845711427 27.581895473868467 49 23.330832708177045 23.93098274568642 24.50612653163291 28.232058014503625 50 24.5 23.125 25.900000000000002 26.474999999999998 51 22.525000000000002 23.875 26.3 27.3 52 24.425 24.95 25.224999999999998 25.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 2.0 21 2.0 22 4.0 23 6.0 24 7.0 25 8.0 26 10.5 27 13.0 28 15.0 29 17.0 30 22.5 31 28.0 32 36.0 33 44.0 34 57.5 35 71.0 36 84.5 37 98.0 38 101.0 39 140.5 40 177.0 41 203.0 42 229.0 43 263.0 44 297.0 45 327.0 46 357.0 47 369.0 48 381.0 49 382.0 50 383.0 51 376.0 52 369.0 53 373.0 54 377.0 55 338.0 56 299.0 57 279.0 58 259.0 59 205.0 60 151.0 61 144.5 62 138.0 63 106.5 64 55.5 65 36.0 66 31.0 67 26.0 68 21.0 69 16.0 70 13.5 71 11.0 72 8.5 73 6.0 74 7.0 75 8.0 76 5.0 77 2.0 78 3.5 79 5.0 80 3.0 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.05 47 0.0 48 0.025 49 0.025 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.325 #Duplication Level Percentage of deduplicated Percentage of total 1 97.17103555670906 93.60000000000001 2 2.2839345964183755 4.3999999999999995 3 0.3893070334804049 1.125 4 0.07786140669608098 0.3 5 0.02595380223202699 0.125 6 0.0 0.0 7 0.02595380223202699 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02595380223202699 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 11 0.27499999999999997 No Hit GGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAA 7 0.17500000000000002 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra Read 200000 spots for SRR5423501.sra Written 200000 spots for SRR5423501.sra SRR ids: ['SRR5423501.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wn2d1g2q SRR5423501.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423501 file size 703954 SRR5423501 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423501 SRR5423501_1.fastq Input file: SRR5423501_1.fastq trimmed: SRR5423501-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 11:46:47 2025 >> started Thu Feb 13 11:46:49 2025 >> done (1.851s) 4000000 reads processed; of these: 188 ( 0.00%) short reads filtered out after trimming by size control 139 ( 0.00%) empty reads filtered out after trimming by size control 3999673 (99.99%) reads available; of these: 62921 ( 1.57%) trimmed reads available after processing 3936752 (98.43%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 8 0.00% 20 5 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 4 0.00% 26 6 0.00% 27 6 0.00% 28 7 0.00% 29 4 0.00% 30 10 0.00% 31 11 0.00% 32 24 0.00% 33 30 0.00% 34 25 0.00% 35 25 0.00% 36 37 0.00% 37 49 0.00% 38 44 0.00% 39 72 0.00% 40 104 0.00% 41 130 0.00% 42 153 0.00% 43 204 0.01% 44 264 0.01% 45 435 0.01% 46 638 0.02% 47 780 0.02% 48 1276 0.03% 49 2616 0.07% 50 6911 0.17% 51 49032 1.23% 52 3936752 98.43% 3999673 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.91 fanout-score-rank=31 prefix-density=0.32 prefix-fanout=1.9 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=22.08 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.7 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 13 11:47:02 Started mapping on | Feb 13 11:47:02 Finished on | Feb 13 11:47:07 Mapping speed, Million of reads per hour | 2879.76 Number of input reads | 3999673 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3426199 Uniquely mapped reads % | 85.66% Average mapped length | 51.85 Number of splices: Total | 413076 Number of splices: Annotated (sjdb) | 409424 Number of splices: GT/AG | 406315 Number of splices: GC/AG | 6171 Number of splices: AT/AC | 205 Number of splices: Non-canonical | 385 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 339609 % of reads mapped to multiple loci | 8.49% Number of reads mapped to too many loci | 222367 % of reads mapped to too many loci | 5.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.28% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 233865 233865 233865 N_multimapping 339609 339609 339609 N_noFeature 157466 3389259 169779 N_ambiguous 41652 25 17012 UnstrandedReadsAssigned:3227081 PositiveStrandReadsAssigned:36915 NegativeStrandReadsAssigned:3239408 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423501 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423501-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,673 reads, 3,578,461 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52401 SRR5423501.ke.tsv 34699 SRR5423501.se.tsv 87100 total ==> SRR5423501.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 39 6.38599 Potri.005G024800.1.v4.1 1035 936 1 0.335709 Potri.004G059700.1.v4.1 961 862 3 1.09359 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 30.2696 3.34438 Potri.016G087400.1.v4.1 270 171 78 143.33 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 68 24.3362 ==> SRR5423501.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 62 Potri.001G212900.v4.1 18 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423501 completed mapping pipeline successfully