Starting /dee2/code/volunteer_pipeline.sh SRR5423502 current disk space = 3093047070720 free memory = 1444485180 SRR5423502 SRAfilesize d3d8888ad1c13515676ba6faeb385683 SRR5423502.sra SRR5423502.sra file validated SRR5423502 is single end SRR5423502 is conventional basespace SRR5423502 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423502_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2285 31.0 31.0 34.0 28.0 34.0 2 31.56275 31.0 31.0 34.0 28.0 34.0 3 31.7685 31.0 31.0 34.0 30.0 34.0 4 31.95675 35.0 30.0 37.0 19.0 37.0 5 34.3005 35.0 33.0 37.0 28.0 37.0 6 35.02875 36.0 35.0 37.0 32.0 37.0 7 35.372 37.0 35.0 37.0 33.0 37.0 8 35.48725 37.0 35.0 37.0 33.0 37.0 9 37.245 39.0 37.0 39.0 33.0 39.0 10 36.982 39.0 37.0 39.0 33.0 39.0 11 37.00225 39.0 37.0 39.0 33.0 39.0 12 37.0665 39.0 37.0 39.0 33.0 39.0 13 37.142 39.0 37.0 39.0 33.0 39.0 14 38.4275 40.0 38.0 41.0 33.0 41.0 15 38.212 40.0 38.0 41.0 33.0 41.0 16 38.3125 40.0 38.0 41.0 33.0 41.0 17 38.19175 40.0 37.0 41.0 33.0 41.0 18 38.163 40.0 38.0 41.0 33.0 41.0 19 38.317 40.0 38.0 41.0 33.0 41.0 20 38.30675 40.0 38.0 41.0 34.0 41.0 21 38.06425 40.0 37.0 41.0 33.0 41.0 22 38.28 40.0 38.0 41.0 34.0 41.0 23 38.12325 40.0 38.0 41.0 33.0 41.0 24 38.202 40.0 38.0 41.0 33.0 41.0 25 38.223 40.0 38.0 41.0 34.0 41.0 26 38.07275 40.0 37.0 41.0 33.0 41.0 27 38.012 40.0 37.0 41.0 33.0 41.0 28 37.851 40.0 37.0 41.0 32.0 41.0 29 38.09825 40.0 38.0 41.0 33.0 41.0 30 38.15225 40.0 38.0 41.0 33.0 41.0 31 38.05475 40.0 37.0 41.0 33.0 41.0 32 37.87575 40.0 37.0 41.0 33.0 41.0 33 37.792 40.0 37.0 41.0 32.0 41.0 34 37.5375 40.0 37.0 41.0 31.0 41.0 35 37.7945 40.0 37.0 41.0 32.0 41.0 36 37.68275 40.0 37.0 41.0 32.0 41.0 37 37.662 40.0 37.0 41.0 32.0 41.0 38 37.51825 40.0 37.0 41.0 31.0 41.0 39 37.529 40.0 37.0 41.0 31.0 41.0 40 37.662 40.0 37.0 41.0 33.0 41.0 41 37.46125 40.0 37.0 41.0 31.0 41.0 42 37.5165 40.0 37.0 41.0 32.0 41.0 43 37.4185 40.0 36.0 41.0 31.0 41.0 44 37.3085 39.0 36.0 41.0 31.0 41.0 45 37.291 39.0 36.0 41.0 31.0 41.0 46 37.172 39.0 36.0 41.0 31.0 41.0 47 37.00825 39.0 36.0 41.0 30.0 41.0 48 37.17475 39.0 36.0 41.0 31.0 41.0 49 37.05475 39.0 36.0 41.0 31.0 41.0 50 36.743 39.0 35.0 40.0 30.0 41.0 51 36.764 39.0 35.0 40.0 30.0 41.0 52 35.8715 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2215 1 0.0 2215 2 0.0 2215 3 0.0 2215 4 0.0 2215 5 0.0 2215 6 0.0 2215 7 0.0 2215 8 0.0 2215 9 0.0 2215 10 0.0 2215 11 0.0 2215 12 0.0 2215 13 0.0 2215 14 0.0 2215 15 0.0 2215 16 0.0 2215 17 0.0 2215 18 0.0 2215 19 0.0 2215 20 0.0 2215 21 0.0 2215 22 0.0 2215 23 0.0 2215 24 0.0 2215 25 0.0 2215 26 0.0 2215 27 0.0 2215 28 0.0 2215 29 0.0 2215 30 0.0 2215 31 0.0 2215 32 0.0 2215 33 0.0 2215 34 0.0 2215 35 0.0 2215 36 0.0 2215 37 0.0 2215 38 0.0 2215 39 0.0 2215 40 0.0 2215 41 0.0 2215 42 0.0 2215 43 0.0 2215 44 0.0 2215 45 0.0 2215 46 0.0 2215 47 0.0 2215 48 0.0 2215 49 0.0 2215 50 0.0 2215 51 0.0 2215 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 1.0 23 2.0 24 3.0 25 12.0 26 26.0 27 25.0 28 38.0 29 61.0 30 76.0 31 102.0 32 100.0 33 148.0 34 200.0 35 259.0 36 366.0 37 513.0 38 824.0 39 1238.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.268268268268265 13.613613613613614 6.406406406406406 36.711711711711715 2 22.5 18.0 33.324999999999996 26.174999999999997 3 19.1 20.95 27.224999999999998 32.725 4 25.124999999999996 27.425 25.025 22.425 5 24.099999999999998 32.75 23.05 20.1 6 21.15 32.275 23.549999999999997 23.025000000000002 7 17.349999999999998 20.9 41.675000000000004 20.075000000000003 8 18.099999999999998 20.3 29.599999999999998 32.0 9 19.55 20.549999999999997 30.275000000000002 29.625 10 20.65 35.35 23.775 20.225 11 25.05 25.224999999999998 21.525 28.199999999999996 12 23.150000000000002 21.625 25.275 29.95 13 20.849999999999998 25.074999999999996 26.924999999999997 27.150000000000002 14 20.674999999999997 25.724999999999998 27.575 26.025 15 22.075 25.025 25.75 27.150000000000002 16 22.8 26.3 24.8 26.1 17 22.95 25.95 24.75 26.35 18 22.650000000000002 25.15 26.200000000000003 26.0 19 22.125 26.174999999999997 25.624999999999996 26.075 20 22.75 25.424999999999997 25.25 26.575 21 22.575 24.4 26.674999999999997 26.35 22 23.674999999999997 24.375 25.724999999999998 26.224999999999998 23 22.55 25.174999999999997 26.450000000000003 25.825 24 23.150000000000002 24.75 25.924999999999997 26.174999999999997 25 23.974999999999998 23.5 26.450000000000003 26.075 26 23.95 25.45 24.45 26.150000000000002 27 23.175 24.375 25.15 27.3 28 23.474999999999998 24.675 24.3 27.55 29 22.625 26.075 25.0 26.3 30 21.65 24.4 26.224999999999998 27.725 31 22.075 25.874999999999996 25.5 26.55 32 23.95 25.124999999999996 25.825 25.1 33 22.95 24.25 27.150000000000002 25.650000000000002 34 23.275000000000002 24.5 24.95 27.275 35 23.3 24.224999999999998 25.2 27.275 36 23.1 25.174999999999997 25.85 25.874999999999996 37 23.075000000000003 24.6 25.0 27.325 38 23.525 25.35 25.7 25.424999999999997 39 22.6 24.85 24.825 27.725 40 22.475 24.75 25.775 27.0 41 22.025 24.625 26.525 26.825 42 22.025 24.9 24.925 28.15 43 23.35 23.325000000000003 24.85 28.475 44 22.875 25.0 26.75 25.374999999999996 45 23.549999999999997 24.2 25.35 26.900000000000002 46 23.0 24.65 25.624999999999996 26.724999999999998 47 22.05 25.8 26.724999999999998 25.424999999999997 48 21.375 23.525 26.0 29.099999999999998 49 23.549999999999997 25.2 25.575 25.674999999999997 50 22.75 24.675 26.6 25.974999999999998 51 23.1 23.025000000000002 26.6 27.275 52 23.75 24.975 24.45 26.825 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 2.0 21 4.0 22 2.5 23 1.0 24 4.5 25 8.0 26 11.0 27 14.0 28 17.0 29 20.0 30 26.5 31 33.0 32 35.5 33 38.0 34 56.0 35 74.0 36 85.5 37 97.0 38 122.5 39 158.0 40 168.0 41 189.0 42 210.0 43 255.5 44 301.0 45 315.0 46 329.0 47 341.0 48 353.0 49 387.5 50 422.0 51 422.5 52 423.0 53 402.5 54 382.0 55 341.0 56 300.0 57 245.0 58 190.0 59 192.0 60 194.0 61 151.5 62 109.0 63 81.5 64 48.5 65 43.0 66 33.0 67 23.0 68 19.5 69 16.0 70 14.5 71 13.0 72 17.0 73 21.0 74 12.0 75 3.0 76 4.0 77 5.0 78 3.5 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.225 #Duplication Level Percentage of deduplicated Percentage of total 1 97.91720236564669 95.19999999999999 2 1.5942401645667268 3.1 3 0.3342761635381846 0.975 4 0.07714065312419646 0.3 5 0.05142710208279763 0.25 6 0.0 0.0 7 0.025713551041398816 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 7 0.17500000000000002 No Hit GGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAA 5 0.125 No Hit GTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra Read 200000 spots for SRR5423502.sra Written 200000 spots for SRR5423502.sra SRR ids: ['SRR5423502.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zsfqfcle SRR5423502.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423502 file size 703966 SRR5423502 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423502 SRR5423502_1.fastq Input file: SRR5423502_1.fastq trimmed: SRR5423502-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 11:50:14 2025 >> started Thu Feb 13 11:50:16 2025 >> done (1.910s) 4000000 reads processed; of these: 191 ( 0.00%) short reads filtered out after trimming by size control 146 ( 0.00%) empty reads filtered out after trimming by size control 3999663 (99.99%) reads available; of these: 66758 ( 1.67%) trimmed reads available after processing 3932905 (98.33%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 3 0.00% 20 7 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 0 0.00% 25 2 0.00% 26 5 0.00% 27 4 0.00% 28 20 0.00% 29 7 0.00% 30 14 0.00% 31 35 0.00% 32 34 0.00% 33 29 0.00% 34 31 0.00% 35 29 0.00% 36 52 0.00% 37 70 0.00% 38 63 0.00% 39 74 0.00% 40 110 0.00% 41 154 0.00% 42 137 0.00% 43 210 0.01% 44 296 0.01% 45 529 0.01% 46 721 0.02% 47 908 0.02% 48 1448 0.04% 49 2914 0.07% 50 7673 0.19% 51 51167 1.28% 52 3932905 98.33% 3999663 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.90 fanout-score-rank=33 prefix-density=0.32 prefix-fanout=1.9 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=22.86 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.7 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 13 11:50:30 Started mapping on | Feb 13 11:50:30 Finished on | Feb 13 11:50:35 Mapping speed, Million of reads per hour | 2879.76 Number of input reads | 3999663 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3426056 Uniquely mapped reads % | 85.66% Average mapped length | 51.85 Number of splices: Total | 413142 Number of splices: Annotated (sjdb) | 409351 Number of splices: GT/AG | 406524 Number of splices: GC/AG | 6001 Number of splices: AT/AC | 207 Number of splices: Non-canonical | 410 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.61 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 339932 % of reads mapped to multiple loci | 8.50% Number of reads mapped to too many loci | 221512 % of reads mapped to too many loci | 5.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.30% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 233675 233675 233675 N_multimapping 339932 339932 339932 N_noFeature 157331 3389104 169699 N_ambiguous 41733 33 17127 UnstrandedReadsAssigned:3226992 PositiveStrandReadsAssigned:36919 NegativeStrandReadsAssigned:3239230 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423502 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423502-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,663 reads, 3,567,685 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,012 rounds 52401 SRR5423502.ke.tsv 34699 SRR5423502.se.tsv 87100 total ==> SRR5423502.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 50 8.20764 Potri.005G024800.1.v4.1 1035 936 2.00192 0.673744 Potri.004G059700.1.v4.1 961 862 4 1.46176 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 30.2953 3.35559 Potri.016G087400.1.v4.1 270 171 77.8165 143.35 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 93 33.3666 ==> SRR5423502.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 64 Potri.001G212900.v4.1 17 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423502 completed mapping pipeline successfully