Starting /dee2/code/volunteer_pipeline.sh SRR5423503 current disk space = 3092677472256 free memory = 1440883912 SRR5423503 SRAfilesize c68198c9aad0d72bfaa7ce2d441e105a SRR5423503.sra SRR5423503.sra file validated SRR5423503 is single end SRR5423503 is conventional basespace SRR5423503 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423503_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.14975 33.0 31.0 34.0 30.0 34.0 2 32.30675 34.0 31.0 34.0 30.0 34.0 3 32.26025 34.0 31.0 34.0 30.0 34.0 4 35.77425 37.0 35.0 37.0 33.0 37.0 5 35.653 37.0 35.0 37.0 33.0 37.0 6 35.65225 37.0 35.0 37.0 33.0 37.0 7 35.7275 37.0 35.0 37.0 33.0 37.0 8 35.818 37.0 35.0 37.0 35.0 37.0 9 37.481 39.0 37.0 39.0 35.0 39.0 10 37.46125 39.0 37.0 39.0 35.0 39.0 11 37.4575 39.0 37.0 39.0 34.0 39.0 12 37.35325 39.0 37.0 39.0 34.0 39.0 13 37.4015 39.0 37.0 39.0 34.0 39.0 14 38.741 40.0 38.0 41.0 34.0 41.0 15 38.704 40.0 38.0 41.0 34.0 41.0 16 38.63825 40.0 38.0 41.0 34.0 41.0 17 38.66075 40.0 38.0 41.0 34.0 41.0 18 38.5515 40.0 38.0 41.0 34.0 41.0 19 38.41125 40.0 38.0 41.0 34.0 41.0 20 38.24575 40.0 38.0 41.0 33.0 41.0 21 38.55325 40.0 38.0 41.0 34.0 41.0 22 38.65075 40.0 38.0 41.0 34.0 41.0 23 38.7815 40.0 38.0 41.0 35.0 41.0 24 38.57175 40.0 38.0 41.0 34.0 41.0 25 38.6425 40.0 38.0 41.0 34.0 41.0 26 38.4625 40.0 38.0 41.0 34.0 41.0 27 38.556 40.0 38.0 41.0 34.0 41.0 28 38.366 40.0 38.0 41.0 33.0 41.0 29 38.35025 40.0 38.0 41.0 34.0 41.0 30 38.344 40.0 38.0 41.0 34.0 41.0 31 38.39025 40.0 38.0 41.0 34.0 41.0 32 38.42275 40.0 38.0 41.0 34.0 41.0 33 38.45925 40.0 38.0 41.0 34.0 41.0 34 38.42 40.0 38.0 41.0 34.0 41.0 35 38.387 40.0 38.0 41.0 34.0 41.0 36 38.22375 40.0 38.0 41.0 34.0 41.0 37 38.223 40.0 38.0 41.0 33.0 41.0 38 38.007 40.0 38.0 41.0 33.0 41.0 39 37.892 40.0 37.0 41.0 33.0 41.0 40 37.92075 40.0 37.0 41.0 33.0 41.0 41 37.36225 40.0 36.0 41.0 31.0 41.0 42 37.5145 40.0 37.0 41.0 32.0 41.0 43 37.666 40.0 37.0 41.0 32.0 41.0 44 37.61775 40.0 37.0 41.0 32.0 41.0 45 37.3765 40.0 37.0 41.0 31.0 41.0 46 37.527 40.0 37.0 41.0 32.0 41.0 47 37.514 40.0 37.0 41.0 32.0 41.0 48 37.317 40.0 36.0 41.0 31.0 41.0 49 37.23975 39.0 36.0 41.0 31.0 41.0 50 36.68225 39.0 35.0 41.0 30.0 41.0 51 37.10825 39.0 36.0 41.0 31.0 41.0 52 36.37025 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2310 1 0.0 2310 2 0.0 2310 3 0.0 2310 4 0.0 2310 5 0.0 2310 6 0.0 2310 7 0.0 2310 8 0.0 2310 9 0.0 2310 10 0.0 2310 11 0.0 2310 12 0.0 2310 13 0.0 2310 14 0.0 2310 15 0.0 2310 16 0.0 2310 17 0.0 2310 18 0.0 2310 19 0.0 2310 20 0.0 2310 21 0.0 2310 22 0.0 2310 23 0.0 2310 24 0.0 2310 25 0.0 2310 26 0.0 2310 27 0.0 2310 28 0.0 2310 29 0.0 2310 30 0.0 2310 31 0.0 2310 32 0.0 2310 33 0.0 2310 34 0.0 2310 35 0.0 2310 36 0.0 2310 37 0.0 2310 38 0.0 2310 39 0.0 2310 40 0.0 2310 41 0.0 2310 42 0.0 2310 43 0.0 2310 44 0.0 2310 45 0.0 2310 46 0.0 2310 47 0.0 2310 48 0.0 2310 49 0.0 2310 50 0.0 2310 51 0.0 2310 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 1.0 23 5.0 24 4.0 25 15.0 26 15.0 27 17.0 28 33.0 29 43.0 30 40.0 31 71.0 32 124.0 33 123.0 34 164.0 35 221.0 36 266.0 37 457.0 38 755.0 39 1641.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.42171085542771 12.956478239119559 7.628814407203602 35.99299649824913 2 23.974999999999998 16.025 34.475 25.525 3 20.275000000000002 20.65 26.174999999999997 32.9 4 25.124999999999996 28.749999999999996 22.05 24.075 5 23.549999999999997 33.2 21.9 21.349999999999998 6 19.825 33.25 22.95 23.974999999999998 7 16.425 20.175 41.65 21.75 8 19.375 20.7 30.325000000000003 29.599999999999998 9 20.025000000000002 20.1 31.15 28.725 10 20.825 35.025 23.275000000000002 20.875 11 25.4 25.074999999999996 20.525 28.999999999999996 12 24.349999999999998 20.849999999999998 25.650000000000002 29.15 13 20.75 25.3 27.725 26.224999999999998 14 22.0 24.875 27.175 25.95 15 22.2 23.625 26.8 27.375 16 23.65 25.650000000000002 24.925 25.775 17 22.8 23.200000000000003 26.8 27.200000000000003 18 21.925 24.224999999999998 26.424999999999997 27.425 19 23.225 25.174999999999997 25.525 26.075 20 22.625 25.3 25.525 26.55 21 22.95 24.925 26.525 25.6 22 23.275000000000002 25.3 25.324999999999996 26.1 23 22.85 24.75 25.775 26.625 24 23.25 24.099999999999998 25.4 27.250000000000004 25 23.175 25.45 26.575 24.8 26 23.799999999999997 23.95 26.650000000000002 25.6 27 22.075 24.875 26.474999999999998 26.575 28 23.625 24.625 24.775 26.974999999999998 29 22.875 24.224999999999998 26.674999999999997 26.224999999999998 30 21.825 24.099999999999998 26.625 27.450000000000003 31 21.775 25.924999999999997 25.1 27.200000000000003 32 23.425 25.825 25.424999999999997 25.324999999999996 33 23.075000000000003 23.25 26.224999999999998 27.450000000000003 34 22.650000000000002 24.7 26.174999999999997 26.474999999999998 35 22.75 24.375 25.55 27.325 36 22.85 24.275 25.45 27.425 37 22.1 24.675 26.625 26.6 38 23.075000000000003 24.4 26.325 26.200000000000003 39 22.900000000000002 23.474999999999998 26.200000000000003 27.425 40 23.125 23.799999999999997 25.3 27.775 41 24.65 23.200000000000003 25.525 26.625 42 22.8 24.575 27.0 25.624999999999996 43 23.150000000000002 24.575 26.55 25.724999999999998 44 23.575 25.324999999999996 26.575 24.525 45 24.15 23.875 25.55 26.424999999999997 46 23.830957739434858 24.031007751937985 26.281570392598148 25.85646411602901 47 23.336668334167083 24.58729364682341 26.013006503251624 26.063031515757878 48 22.311155577788895 24.23711855927964 25.83791895947974 27.613806903451728 49 22.400000000000002 25.900000000000002 24.5 27.200000000000003 50 23.411705852926463 25.287643821910955 24.987493746873437 26.313156578289142 51 22.5 23.45 26.625 27.425 52 23.724999999999998 23.549999999999997 25.624999999999996 27.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 2.5 21 4.0 22 4.0 23 4.0 24 3.5 25 3.0 26 7.0 27 11.0 28 13.0 29 15.0 30 21.0 31 27.0 32 35.5 33 44.0 34 56.5 35 69.0 36 79.0 37 89.0 38 105.0 39 147.0 40 173.0 41 205.0 42 237.0 43 257.5 44 278.0 45 318.5 46 359.0 47 365.5 48 372.0 49 378.5 50 385.0 51 398.5 52 412.0 53 401.5 54 391.0 55 349.5 56 308.0 57 273.5 58 239.0 59 204.5 60 170.0 61 137.0 62 104.0 63 81.5 64 56.5 65 54.0 66 35.5 67 17.0 68 15.5 69 14.0 70 15.5 71 17.0 72 14.0 73 11.0 74 8.5 75 6.0 76 5.0 77 4.0 78 2.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.05 48 0.05 49 0.0 50 0.05 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.8 #Duplication Level Percentage of deduplicated Percentage of total 1 97.21074380165288 94.1 2 2.4018595041322315 4.65 3 0.30991735537190085 0.8999999999999999 4 0.05165289256198347 0.2 5 0.0 0.0 6 0.025826446280991736 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra Read 129525 spots for SRR5423503.sra Written 129525 spots for SRR5423503.sra Read 129521 spots for SRR5423503.sra Written 129521 spots for SRR5423503.sra SRR ids: ['SRR5423503.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pyv7f3v_ SRR5423503.sra spots: 2590424 blocks: [[1, 129521], [129522, 259042], [259043, 388563], [388564, 518084], [518085, 647605], [647606, 777126], [777127, 906647], [906648, 1036168], [1036169, 1165689], [1165690, 1295210], [1295211, 1424731], [1424732, 1554252], [1554253, 1683773], [1683774, 1813294], [1813295, 1942815], [1942816, 2072336], [2072337, 2201857], [2201858, 2331378], [2331379, 2460899], [2460900, 2590424]] SRR5423503 file size 455521 SRR5423503 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423503 SRR5423503_1.fastq Input file: SRR5423503_1.fastq trimmed: SRR5423503-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:06:43 2025 >> started Thu Feb 13 12:06:45 2025 >> done (1.194s) 2590424 reads processed; of these: 116 ( 0.00%) short reads filtered out after trimming by size control 64 ( 0.00%) empty reads filtered out after trimming by size control 2590244 (99.99%) reads available; of these: 38582 ( 1.49%) trimmed reads available after processing 2551662 (98.51%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 7 0.00% 20 9 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 1 0.00% 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 3 0.00% 32 3 0.00% 33 1 0.00% 34 6 0.00% 35 3 0.00% 36 10 0.00% 37 5 0.00% 38 4 0.00% 39 21 0.00% 40 26 0.00% 41 33 0.00% 42 51 0.00% 43 41 0.00% 44 67 0.00% 45 108 0.00% 46 211 0.01% 47 314 0.01% 48 517 0.02% 49 1272 0.05% 50 3965 0.15% 51 31890 1.23% 52 2551662 98.51% 2590244 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=26 prefix-density=0.27 prefix-fanout=1.8 sequence=ACCTTCAACTCAGCGAATGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=23.69 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.7 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 13 12:06:57 Started mapping on | Feb 13 12:06:57 Finished on | Feb 13 12:07:01 Mapping speed, Million of reads per hour | 2331.22 Number of input reads | 2590244 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2218889 Uniquely mapped reads % | 85.66% Average mapped length | 51.85 Number of splices: Total | 268084 Number of splices: Annotated (sjdb) | 265731 Number of splices: GT/AG | 263821 Number of splices: GC/AG | 3886 Number of splices: AT/AC | 140 Number of splices: Non-canonical | 237 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 218577 % of reads mapped to multiple loci | 8.44% Number of reads mapped to too many loci | 145498 % of reads mapped to too many loci | 5.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.28% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 152778 152778 152778 N_multimapping 218577 218577 218577 N_noFeature 102902 2195336 110723 N_ambiguous 26874 11 11135 UnstrandedReadsAssigned:2089113 PositiveStrandReadsAssigned:23542 NegativeStrandReadsAssigned:2097031 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423503 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423503-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,590,244 reads, 2,312,663 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52401 SRR5423503.ke.tsv 34699 SRR5423503.se.tsv 87100 total ==> SRR5423503.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 29 7.36106 Potri.005G024800.1.v4.1 1035 936 3 1.56122 Potri.004G059700.1.v4.1 961 862 4 2.26032 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 18.121 3.10364 Potri.016G087400.1.v4.1 270 171 51 145.275 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 61 33.8418 ==> SRR5423503.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 45 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423503 completed mapping pipeline successfully