Starting /dee2/code/volunteer_pipeline.sh SRR5423504 current disk space = 3051873472512 free memory = 1437059624 SRR5423504 SRAfilesize 87676926bdbe8a0014026fb8b54930e5 SRR5423504.sra SRR5423504.sra file validated SRR5423504 is single end SRR5423504 is conventional basespace SRR5423504 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423504_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.9345 34.0 31.0 34.0 30.0 34.0 2 31.942 34.0 31.0 34.0 30.0 34.0 3 32.66375 34.0 31.0 34.0 30.0 34.0 4 36.20575 37.0 37.0 37.0 35.0 37.0 5 36.23375 37.0 37.0 37.0 35.0 37.0 6 36.2615 37.0 37.0 37.0 35.0 37.0 7 36.29725 37.0 37.0 37.0 35.0 37.0 8 36.2775 37.0 37.0 37.0 35.0 37.0 9 38.1925 39.0 39.0 39.0 37.0 39.0 10 38.021 39.0 38.0 39.0 37.0 39.0 11 37.86325 39.0 38.0 39.0 35.0 39.0 12 38.05175 39.0 38.0 39.0 36.0 39.0 13 38.00275 39.0 38.0 39.0 35.0 39.0 14 39.52 41.0 39.0 41.0 37.0 41.0 15 39.47375 41.0 39.0 41.0 37.0 41.0 16 39.392 41.0 39.0 41.0 36.0 41.0 17 39.45825 41.0 39.0 41.0 37.0 41.0 18 39.56225 41.0 39.0 41.0 37.0 41.0 19 39.4945 41.0 40.0 41.0 37.0 41.0 20 39.47825 41.0 40.0 41.0 37.0 41.0 21 39.3365 41.0 39.0 41.0 36.0 41.0 22 39.322 41.0 39.0 41.0 36.0 41.0 23 39.2985 41.0 39.0 41.0 36.0 41.0 24 39.20075 41.0 39.0 41.0 36.0 41.0 25 39.18475 41.0 39.0 41.0 36.0 41.0 26 39.07375 41.0 39.0 41.0 36.0 41.0 27 39.019 40.0 39.0 41.0 36.0 41.0 28 39.05425 40.0 39.0 41.0 36.0 41.0 29 39.0395 40.0 39.0 41.0 36.0 41.0 30 39.035 40.0 39.0 41.0 36.0 41.0 31 39.00275 40.0 39.0 41.0 36.0 41.0 32 38.90175 40.0 39.0 41.0 35.0 41.0 33 38.792 40.0 39.0 41.0 35.0 41.0 34 38.7405 40.0 38.0 41.0 35.0 41.0 35 38.71825 40.0 38.0 41.0 35.0 41.0 36 38.7095 40.0 38.0 41.0 35.0 41.0 37 38.598 40.0 38.0 41.0 34.0 41.0 38 38.5525 40.0 38.0 41.0 34.0 41.0 39 38.5255 40.0 38.0 41.0 34.0 41.0 40 38.3335 40.0 38.0 41.0 34.0 41.0 41 38.1405 40.0 38.0 41.0 33.0 41.0 42 38.01675 40.0 38.0 41.0 33.0 41.0 43 38.04625 40.0 38.0 41.0 33.0 41.0 44 37.93975 40.0 38.0 41.0 33.0 41.0 45 37.963 40.0 38.0 41.0 33.0 41.0 46 37.88175 40.0 38.0 41.0 33.0 41.0 47 37.866 40.0 38.0 41.0 33.0 41.0 48 37.772 40.0 37.0 41.0 33.0 41.0 49 37.60525 40.0 37.0 41.0 32.0 41.0 50 37.537 40.0 37.0 41.0 32.0 41.0 51 37.49325 40.0 37.0 41.0 32.0 41.0 52 35.70975 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 4.0 21 4.0 22 4.0 23 5.0 24 5.0 25 6.0 26 17.0 27 11.0 28 22.0 29 27.0 30 43.0 31 52.0 32 57.0 33 82.0 34 107.0 35 149.0 36 214.0 37 358.0 38 769.0 39 2049.0 40 12.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.613969608104505 14.502799253532391 5.465209277525993 32.41802186083711 2 22.925 15.0 34.849999999999994 27.224999999999998 3 19.125 20.0 28.575 32.300000000000004 4 24.45 28.1 23.599999999999998 23.849999999999998 5 23.525 31.924999999999997 23.625 20.925 6 19.55 30.525000000000002 24.575 25.35 7 16.675 19.225 43.05 21.05 8 18.3 21.025 29.575000000000003 31.1 9 18.95 20.125 32.0 28.925 10 21.475 35.35 22.725 20.45 11 25.75 24.075 20.424999999999997 29.75 12 22.725 19.675 26.700000000000003 30.9 13 20.875 25.124999999999996 27.800000000000004 26.200000000000003 14 20.825 24.15 28.7 26.325 15 21.125 25.124999999999996 27.35 26.400000000000002 16 21.95 23.825 27.0 27.224999999999998 17 20.875 25.275 27.1 26.75 18 22.025 24.2 25.525 28.249999999999996 19 23.1 25.724999999999998 24.675 26.5 20 23.65 24.474999999999998 26.400000000000002 25.474999999999998 21 23.20580145036259 23.95598899724931 26.331582895723933 26.506626656664167 22 23.775 25.825 24.25 26.150000000000002 23 23.45 25.6 25.35 25.6 24 23.1 24.875 25.624999999999996 26.400000000000002 25 22.75 24.675 25.174999999999997 27.400000000000002 26 22.8 24.45 25.85 26.900000000000002 27 21.224999999999998 23.425 26.200000000000003 29.15 28 22.725 25.775 24.825 26.674999999999997 29 22.85 24.625 25.424999999999997 27.1 30 21.675 25.275 25.825 27.224999999999998 31 22.025 25.1 26.1 26.775 32 21.55 24.474999999999998 26.375 27.6 33 22.725 25.025 25.55 26.700000000000003 34 22.125 25.874999999999996 25.474999999999998 26.525 35 21.975 23.625 26.85 27.55 36 20.95 24.875 25.275 28.9 37 22.15 25.75 25.45 26.650000000000002 38 22.7 24.725 25.4 27.175 39 22.8 23.799999999999997 24.525 28.875 40 23.1 25.474999999999998 24.275 27.150000000000002 41 23.05 25.424999999999997 25.724999999999998 25.8 42 22.680670167541887 25.78144536134033 25.581395348837212 25.95648912228057 43 23.075000000000003 24.0 26.025 26.900000000000002 44 22.45 24.075 26.125 27.35 45 24.0 24.25 25.25 26.5 46 24.3 23.849999999999998 24.45 27.400000000000002 47 24.425 23.549999999999997 26.1 25.924999999999997 48 23.355838959739934 22.030507626906726 26.156539134783696 28.457114278569644 49 23.474999999999998 23.724999999999998 24.65 28.15 50 22.900000000000002 24.474999999999998 26.525 26.1 51 21.4 24.075 25.424999999999997 29.099999999999998 52 23.974999999999998 23.35 25.174999999999997 27.500000000000004 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 2.0 18 1.5 19 1.0 20 1.5 21 2.0 22 2.5 23 3.0 24 4.5 25 6.0 26 7.0 27 8.0 28 16.0 29 24.0 30 31.0 31 38.0 32 41.5 33 45.0 34 57.5 35 70.0 36 78.5 37 87.0 38 109.5 39 151.5 40 171.0 41 197.0 42 223.0 43 249.5 44 276.0 45 301.5 46 327.0 47 352.0 48 377.0 49 398.0 50 419.0 51 410.0 52 401.0 53 389.5 54 378.0 55 340.0 56 302.0 57 260.5 58 219.0 59 198.5 60 178.0 61 138.0 62 98.0 63 81.0 64 59.5 65 55.0 66 40.5 67 26.0 68 22.0 69 18.0 70 15.0 71 12.0 72 14.5 73 17.0 74 11.0 75 5.0 76 5.0 77 5.0 78 4.5 79 4.0 80 3.0 81 2.0 82 1.5 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.025 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.025 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.55 #Duplication Level Percentage of deduplicated Percentage of total 1 97.54013464526152 94.175 2 1.8125323666494046 3.5000000000000004 3 0.4142931123770067 1.2 4 0.18125323666494045 0.7000000000000001 5 0.02589331952356292 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02589331952356292 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 12 0.3 No Hit GTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra Read 200000 spots for SRR5423504.sra Written 200000 spots for SRR5423504.sra SRR ids: ['SRR5423504.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5kg_z7qd SRR5423504.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423504 file size 704002 SRR5423504 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423504 SRR5423504_1.fastq Input file: SRR5423504_1.fastq trimmed: SRR5423504-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 15:57:58 2025 >> started Wed Feb 12 15:57:59 2025 >> done (1.673s) 4000000 reads processed; of these: 255 ( 0.01%) short reads filtered out after trimming by size control 183 ( 0.00%) empty reads filtered out after trimming by size control 3999562 (99.99%) reads available; of these: 61943 ( 1.55%) trimmed reads available after processing 3937619 (98.45%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 6 0.00% 20 12 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 2 0.00% 26 8 0.00% 27 8 0.00% 28 17 0.00% 29 9 0.00% 30 16 0.00% 31 16 0.00% 32 28 0.00% 33 25 0.00% 34 22 0.00% 35 24 0.00% 36 32 0.00% 37 65 0.00% 38 52 0.00% 39 54 0.00% 40 80 0.00% 41 153 0.00% 42 129 0.00% 43 175 0.00% 44 250 0.01% 45 436 0.01% 46 671 0.02% 47 810 0.02% 48 1150 0.03% 49 2512 0.06% 50 6931 0.17% 51 48226 1.21% 52 3937619 98.45% 3999562 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=29 prefix-density=0.23 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=29.32 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 12 15:58:10 Started mapping on | Feb 12 15:58:10 Finished on | Feb 12 15:58:16 Mapping speed, Million of reads per hour | 2399.74 Number of input reads | 3999562 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3400859 Uniquely mapped reads % | 85.03% Average mapped length | 51.85 Number of splices: Total | 417697 Number of splices: Annotated (sjdb) | 413357 Number of splices: GT/AG | 410085 Number of splices: GC/AG | 7038 Number of splices: AT/AC | 219 Number of splices: Non-canonical | 355 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300286 % of reads mapped to multiple loci | 7.51% Number of reads mapped to too many loci | 284558 % of reads mapped to too many loci | 7.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.34% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 298417 298417 298417 N_multimapping 300286 300286 300286 N_noFeature 224776 3358690 240592 N_ambiguous 43507 36 17132 UnstrandedReadsAssigned:3132576 PositiveStrandReadsAssigned:42133 NegativeStrandReadsAssigned:3143135 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423504 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423504-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,562 reads, 3,465,929 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR5423504.ke.tsv 34699 SRR5423504.se.tsv 87100 total ==> SRR5423504.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 60 9.66914 Potri.005G024800.1.v4.1 1035 936 7 2.31278 Potri.004G059700.1.v4.1 961 862 12 4.30512 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 26.3264 2.86269 Potri.016G087400.1.v4.1 270 171 75 135.637 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 80 28.1778 ==> SRR5423504.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 60 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR5423504 completed mapping pipeline successfully