Starting /dee2/code/volunteer_pipeline.sh SRR5423505 current disk space = 3093308841984 free memory = 1381229076 SRR5423505 SRAfilesize 8e63c62d6479d0a0dbdfb1c965d0c707 SRR5423505.sra SRR5423505.sra file validated SRR5423505 is single end SRR5423505 is conventional basespace SRR5423505 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423505_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.341 31.0 31.0 34.0 28.0 34.0 2 31.83925 33.0 31.0 34.0 30.0 34.0 3 31.948 33.0 31.0 34.0 30.0 34.0 4 32.3755 35.0 32.0 37.0 19.0 37.0 5 34.506 35.0 35.0 37.0 28.0 37.0 6 35.13225 37.0 35.0 37.0 32.0 37.0 7 35.4365 37.0 35.0 37.0 33.0 37.0 8 35.558 37.0 35.0 37.0 33.0 37.0 9 37.40625 39.0 37.0 39.0 34.0 39.0 10 37.29725 39.0 37.0 39.0 34.0 39.0 11 37.3055 39.0 37.0 39.0 34.0 39.0 12 37.3145 39.0 37.0 39.0 34.0 39.0 13 37.28 39.0 37.0 39.0 34.0 39.0 14 38.40925 40.0 38.0 41.0 33.0 41.0 15 38.36775 40.0 38.0 41.0 33.0 41.0 16 38.4595 40.0 38.0 41.0 34.0 41.0 17 38.60225 40.0 38.0 41.0 34.0 41.0 18 38.41375 40.0 38.0 41.0 33.0 41.0 19 38.358 40.0 38.0 41.0 34.0 41.0 20 38.291 40.0 38.0 41.0 34.0 41.0 21 38.2095 40.0 37.0 41.0 33.0 41.0 22 38.37375 40.0 38.0 41.0 34.0 41.0 23 38.44625 40.0 38.0 41.0 34.0 41.0 24 38.219 40.0 38.0 41.0 33.0 41.0 25 38.302 40.0 38.0 41.0 34.0 41.0 26 38.33725 40.0 38.0 41.0 34.0 41.0 27 38.25625 40.0 38.0 41.0 34.0 41.0 28 37.994 40.0 38.0 41.0 33.0 41.0 29 38.0255 40.0 37.0 41.0 33.0 41.0 30 38.12125 40.0 38.0 41.0 33.0 41.0 31 38.1325 40.0 38.0 41.0 33.0 41.0 32 38.23375 40.0 38.0 41.0 33.0 41.0 33 38.25475 40.0 38.0 41.0 34.0 41.0 34 38.35925 40.0 38.0 41.0 34.0 41.0 35 38.23475 40.0 38.0 41.0 34.0 41.0 36 37.988 40.0 38.0 41.0 33.0 41.0 37 37.96825 40.0 37.0 41.0 33.0 41.0 38 37.884 40.0 37.0 41.0 33.0 41.0 39 37.73425 40.0 37.0 41.0 32.0 41.0 40 37.70425 40.0 37.0 41.0 32.0 41.0 41 37.63875 40.0 37.0 41.0 32.0 41.0 42 37.638 40.0 37.0 41.0 32.0 41.0 43 37.4615 40.0 37.0 41.0 32.0 41.0 44 37.51725 39.0 37.0 41.0 31.0 41.0 45 37.53125 40.0 36.0 41.0 32.0 41.0 46 37.54625 40.0 36.0 41.0 32.0 41.0 47 37.38525 39.0 36.0 41.0 32.0 41.0 48 37.0675 39.0 36.0 41.0 31.0 41.0 49 37.10775 39.0 36.0 41.0 31.0 41.0 50 37.3125 39.0 36.0 41.0 31.0 41.0 51 37.044 39.0 36.0 41.0 31.0 41.0 52 36.4445 39.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1115 1 0.0 1115 2 0.0 1115 3 0.0 1115 4 0.0 1115 5 0.0 1115 6 0.0 1115 7 0.0 1115 8 0.0 1115 9 0.0 1115 10 0.0 1115 11 0.0 1115 12 0.0 1115 13 0.0 1115 14 0.0 1115 15 0.0 1115 16 0.0 1115 17 0.0 1115 18 0.0 1115 19 0.0 1115 20 0.0 1115 21 0.0 1115 22 0.0 1115 23 0.0 1115 24 0.0 1115 25 0.0 1115 26 0.0 1115 27 0.0 1115 28 0.0 1115 29 0.0 1115 30 0.0 1115 31 0.0 1115 32 0.0 1115 33 0.0 1115 34 0.0 1115 35 0.0 1115 36 0.0 1115 37 0.0 1115 38 0.0 1115 39 0.0 1115 40 0.0 1115 41 0.0 1115 42 0.0 1115 43 0.0 1115 44 0.0 1115 45 0.0 1115 46 0.0 1115 47 0.0 1115 48 0.0 1115 49 0.0 1115 50 0.0 1115 51 0.0 1115 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 3.0 24 5.0 25 10.0 26 18.0 27 27.0 28 39.0 29 52.0 30 67.0 31 69.0 32 108.0 33 152.0 34 149.0 35 261.0 36 334.0 37 511.0 38 815.0 39 1372.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.057350363135484 14.825945404457801 5.159028299524167 32.957675932882545 2 21.25 16.175 36.15 26.424999999999997 3 19.55 19.400000000000002 28.65 32.4 4 25.674999999999997 27.700000000000003 24.05 22.575 5 24.025 32.550000000000004 23.400000000000002 20.025000000000002 6 21.075 31.175000000000004 23.875 23.875 7 16.75 19.8 42.449999999999996 21.0 8 17.625 20.65 30.5 31.225 9 18.35 20.05 32.0 29.599999999999998 10 19.025 35.675000000000004 24.8 20.5 11 25.575 24.375 20.25 29.799999999999997 12 24.175 20.674999999999997 23.549999999999997 31.6 13 20.95 25.05 27.925 26.075 14 22.0 25.2 27.375 25.424999999999997 15 21.325 24.55 27.200000000000003 26.924999999999997 16 22.85 25.275 24.9 26.974999999999998 17 21.375 24.95 27.150000000000002 26.525 18 20.95 24.025 26.575 28.449999999999996 19 22.225 26.950000000000003 24.25 26.575 20 23.35 24.4 25.674999999999997 26.575 21 22.025 23.7 25.25 29.025000000000002 22 22.925 25.0 25.924999999999997 26.150000000000002 23 23.025000000000002 24.5 25.8 26.674999999999997 24 22.35 23.549999999999997 26.200000000000003 27.900000000000002 25 22.900000000000002 24.25 24.85 28.000000000000004 26 23.599999999999998 24.25 26.650000000000002 25.5 27 22.2 25.174999999999997 25.374999999999996 27.250000000000004 28 22.825 25.374999999999996 25.525 26.275 29 22.650000000000002 24.725 26.1 26.525 30 20.375 24.425 26.35 28.849999999999998 31 22.075 24.975 25.55 27.400000000000002 32 22.675 25.025 25.624999999999996 26.674999999999997 33 22.8 23.9 26.224999999999998 27.075 34 21.175 25.55 25.575 27.700000000000003 35 22.05 24.65 26.224999999999998 27.075 36 21.15 25.55 26.35 26.950000000000003 37 21.6 25.825 24.425 28.15 38 21.625 24.0 26.55 27.825 39 22.15 23.674999999999997 25.825 28.349999999999998 40 22.05 25.900000000000002 25.224999999999998 26.825 41 22.875 25.275 26.1 25.75 42 23.125 24.45 25.724999999999998 26.700000000000003 43 23.799999999999997 24.625 25.074999999999996 26.5 44 22.725 24.875 26.125 26.275 45 23.974999999999998 23.200000000000003 25.674999999999997 27.150000000000002 46 22.375 24.25 25.1 28.275 47 23.1 25.3 25.374999999999996 26.224999999999998 48 24.425 23.65 24.125 27.800000000000004 49 23.9 24.675 25.35 26.075 50 22.75 24.575 25.95 26.724999999999998 51 21.825 23.025000000000002 25.974999999999998 29.175 52 22.75 23.95 25.575 27.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 2.0 21 3.0 22 2.5 23 2.0 24 4.5 25 7.0 26 8.5 27 10.0 28 16.0 29 22.0 30 23.5 31 25.0 32 37.5 33 50.0 34 66.5 35 83.0 36 90.5 37 98.0 38 103.5 39 149.0 40 189.0 41 206.0 42 223.0 43 253.0 44 283.0 45 298.5 46 314.0 47 348.5 48 383.0 49 384.5 50 386.0 51 399.0 52 412.0 53 391.5 54 371.0 55 344.5 56 318.0 57 269.0 58 220.0 59 196.0 60 172.0 61 139.0 62 106.0 63 91.5 64 66.0 65 55.0 66 40.5 67 26.0 68 22.0 69 18.0 70 15.5 71 13.0 72 13.0 73 13.0 74 9.0 75 5.0 76 4.0 77 3.0 78 2.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.60371038392167 94.69999999999999 2 2.061324400927596 4.0 3 0.1545993300695697 0.44999999999999996 4 0.1030662200463798 0.4 5 0.02576655501159495 0.125 6 0.02576655501159495 0.15 7 0.02576655501159495 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 7 0.17500000000000002 No Hit GTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAAT 6 0.15 No Hit GCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra Read 200000 spots for SRR5423505.sra Written 200000 spots for SRR5423505.sra SRR ids: ['SRR5423505.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tkixap5p SRR5423505.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423505 file size 703982 SRR5423505 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423505 SRR5423505_1.fastq Input file: SRR5423505_1.fastq trimmed: SRR5423505-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 11:40:13 2025 >> started Thu Feb 13 11:40:15 2025 >> done (1.988s) 4000000 reads processed; of these: 278 ( 0.01%) short reads filtered out after trimming by size control 185 ( 0.00%) empty reads filtered out after trimming by size control 3999537 (99.99%) reads available; of these: 76839 ( 1.92%) trimmed reads available after processing 3922698 (98.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 6 0.00% 20 4 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 4 0.00% 25 5 0.00% 26 5 0.00% 27 13 0.00% 28 23 0.00% 29 18 0.00% 30 12 0.00% 31 29 0.00% 32 56 0.00% 33 39 0.00% 34 20 0.00% 35 42 0.00% 36 44 0.00% 37 87 0.00% 38 90 0.00% 39 79 0.00% 40 142 0.00% 41 194 0.00% 42 182 0.00% 43 297 0.01% 44 339 0.01% 45 626 0.02% 46 845 0.02% 47 1130 0.03% 48 1614 0.04% 49 3383 0.08% 50 8632 0.22% 51 58866 1.47% 52 3922698 98.08% 3999537 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=32 prefix-density=0.22 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=21.93 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.6 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 13 11:40:29 Started mapping on | Feb 13 11:40:29 Finished on | Feb 13 11:40:34 Mapping speed, Million of reads per hour | 2879.67 Number of input reads | 3999537 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3403047 Uniquely mapped reads % | 85.09% Average mapped length | 51.84 Number of splices: Total | 420615 Number of splices: Annotated (sjdb) | 416025 Number of splices: GT/AG | 412842 Number of splices: GC/AG | 7117 Number of splices: AT/AC | 221 Number of splices: Non-canonical | 435 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300312 % of reads mapped to multiple loci | 7.51% Number of reads mapped to too many loci | 281424 % of reads mapped to too many loci | 7.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.37% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 296178 296178 296178 N_multimapping 300312 300312 300312 N_noFeature 223524 3361103 239215 N_ambiguous 43259 37 16986 UnstrandedReadsAssigned:3136264 PositiveStrandReadsAssigned:41907 NegativeStrandReadsAssigned:3146846 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423505 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423505-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,537 reads, 3,465,170 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52401 SRR5423505.ke.tsv 34699 SRR5423505.se.tsv 87100 total ==> SRR5423505.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 54 8.71034 Potri.005G024800.1.v4.1 1035 936 12 3.96846 Potri.004G059700.1.v4.1 961 862 13 4.66823 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 29.175 3.17539 Potri.016G087400.1.v4.1 270 171 85 153.865 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 62 21.8581 ==> SRR5423505.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 48 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423505 completed mapping pipeline successfully