Starting /dee2/code/volunteer_pipeline.sh SRR5423506 current disk space = 3093054619648 free memory = 1381585036 SRR5423506 SRAfilesize 3d502c8f1ee5925b65405ecc9e535767 SRR5423506.sra SRR5423506.sra file validated SRR5423506 is single end SRR5423506 is conventional basespace SRR5423506 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423506_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8135 33.0 31.0 34.0 30.0 34.0 2 32.02925 33.0 31.0 34.0 30.0 34.0 3 32.11125 34.0 31.0 34.0 30.0 34.0 4 34.63225 37.0 35.0 37.0 30.0 37.0 5 35.415 37.0 35.0 37.0 33.0 37.0 6 35.55775 37.0 35.0 37.0 33.0 37.0 7 35.66425 37.0 35.0 37.0 33.0 37.0 8 35.75775 37.0 35.0 37.0 35.0 37.0 9 37.332 39.0 37.0 39.0 34.0 39.0 10 37.2325 39.0 37.0 39.0 33.0 39.0 11 37.2385 39.0 37.0 39.0 33.0 39.0 12 37.447 39.0 37.0 39.0 34.0 39.0 13 37.326 39.0 37.0 39.0 34.0 39.0 14 38.689 40.0 38.0 41.0 34.0 41.0 15 38.588 40.0 38.0 41.0 34.0 41.0 16 38.47 40.0 38.0 41.0 33.0 41.0 17 38.19625 40.0 38.0 41.0 33.0 41.0 18 38.39575 40.0 38.0 41.0 34.0 41.0 19 38.447 40.0 38.0 41.0 34.0 41.0 20 38.464 40.0 38.0 41.0 34.0 41.0 21 38.3635 40.0 38.0 41.0 34.0 41.0 22 38.439 40.0 38.0 41.0 34.0 41.0 23 38.347 40.0 38.0 41.0 34.0 41.0 24 38.287 40.0 38.0 41.0 34.0 41.0 25 38.407 40.0 38.0 41.0 34.0 41.0 26 38.4735 40.0 38.0 41.0 34.0 41.0 27 38.2315 40.0 38.0 41.0 34.0 41.0 28 38.30375 40.0 38.0 41.0 34.0 41.0 29 38.278 40.0 38.0 41.0 34.0 41.0 30 38.20875 40.0 38.0 41.0 33.0 41.0 31 38.30225 40.0 38.0 41.0 34.0 41.0 32 38.381 40.0 38.0 41.0 34.0 41.0 33 38.31275 40.0 38.0 41.0 34.0 41.0 34 38.34125 40.0 38.0 41.0 34.0 41.0 35 38.34275 40.0 38.0 41.0 34.0 41.0 36 38.07975 40.0 37.0 41.0 33.0 41.0 37 38.029 40.0 37.0 41.0 33.0 41.0 38 38.00225 40.0 37.0 41.0 33.0 41.0 39 37.78875 40.0 37.0 41.0 32.0 41.0 40 37.7445 40.0 37.0 41.0 33.0 41.0 41 37.7855 40.0 37.0 41.0 33.0 41.0 42 37.699 40.0 37.0 41.0 32.0 41.0 43 37.638 40.0 37.0 41.0 32.0 41.0 44 37.54475 40.0 37.0 41.0 32.0 41.0 45 37.62875 40.0 37.0 41.0 32.0 41.0 46 37.29925 40.0 36.0 41.0 31.0 41.0 47 37.295 39.0 36.0 41.0 31.0 41.0 48 37.092 39.0 36.0 41.0 31.0 41.0 49 37.0725 39.0 36.0 41.0 31.0 41.0 50 36.87925 39.0 35.0 41.0 30.0 41.0 51 37.10025 39.0 35.0 41.0 31.0 41.0 52 35.9605 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1213 1 0.0 1213 2 0.0 1213 3 0.0 1213 4 0.0 1213 5 0.0 1213 6 0.0 1213 7 0.0 1213 8 0.0 1213 9 0.0 1213 10 0.0 1213 11 0.0 1213 12 0.0 1213 13 0.0 1213 14 0.0 1213 15 0.0 1213 16 0.0 1213 17 0.0 1213 18 0.0 1213 19 0.0 1213 20 0.0 1213 21 0.0 1213 22 0.0 1213 23 0.0 1213 24 0.0 1213 25 0.0 1213 26 0.0 1213 27 0.0 1213 28 0.0 1213 29 0.0 1213 30 0.0 1213 31 0.0 1213 32 0.0 1213 33 0.0 1213 34 0.0 1213 35 0.0 1213 36 0.0 1213 37 0.0 1213 38 0.0 1213 39 0.0 1213 40 0.0 1213 41 0.0 1213 42 0.0 1213 43 0.0 1213 44 0.0 1213 45 0.0 1213 46 0.0 1213 47 0.0 1213 48 0.0 1213 49 0.0 1213 50 0.0 1213 51 0.0 1213 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 2.0 19 0.0 20 0.0 21 1.0 22 1.0 23 2.0 24 6.0 25 10.0 26 12.0 27 27.0 28 26.0 29 41.0 30 62.0 31 73.0 32 118.0 33 136.0 34 190.0 35 261.0 36 315.0 37 420.0 38 727.0 39 1560.0 40 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.59489233850776 14.146219328993489 5.057586379569353 34.20130195292939 2 22.825 16.25 33.25 27.675 3 20.45 21.125 26.55 31.874999999999996 4 23.5 30.45 22.425 23.625 5 23.175 33.575 23.225 20.025000000000002 6 20.825 32.550000000000004 22.675 23.95 7 16.425 21.3 41.75 20.525 8 19.6 20.25 29.549999999999997 30.599999999999998 9 18.85 19.3 32.225 29.625 10 20.5 34.9 23.5 21.099999999999998 11 25.624999999999996 24.625 20.0 29.75 12 22.725 21.75 25.7 29.825000000000003 13 21.675 24.5 27.275 26.55 14 21.2 24.95 28.4 25.45 15 21.525 24.55 27.075 26.85 16 22.975 25.074999999999996 25.474999999999998 26.474999999999998 17 22.275 25.25 26.650000000000002 25.825 18 21.6 23.775 28.025 26.6 19 24.075 24.9 25.624999999999996 25.4 20 22.225 25.374999999999996 26.55 25.85 21 23.0 23.45 25.45 28.1 22 23.025000000000002 24.775 24.925 27.275 23 20.95 25.45 26.85 26.75 24 23.025000000000002 23.1 25.75 28.125 25 23.025000000000002 25.5 25.05 26.424999999999997 26 23.125 25.224999999999998 25.05 26.6 27 21.7 24.349999999999998 26.474999999999998 27.474999999999998 28 23.3 24.349999999999998 26.150000000000002 26.200000000000003 29 22.400000000000002 25.224999999999998 25.575 26.8 30 21.375 24.075 25.924999999999997 28.625 31 21.925 25.324999999999996 25.85 26.900000000000002 32 22.2 24.8 26.200000000000003 26.8 33 21.425 24.625 26.674999999999997 27.275 34 22.225 25.3 26.0 26.474999999999998 35 24.325 23.200000000000003 26.150000000000002 26.325 36 22.425 25.224999999999998 25.974999999999998 26.375 37 24.2 24.325 25.124999999999996 26.35 38 22.975 25.35 25.0 26.674999999999997 39 22.125 23.599999999999998 25.650000000000002 28.625 40 22.0 24.6 25.924999999999997 27.474999999999998 41 22.025 24.4 25.8 27.775 42 21.05 25.124999999999996 25.95 27.875 43 23.974999999999998 23.625 25.6 26.8 44 22.775000000000002 23.599999999999998 27.625 26.0 45 22.925 23.799999999999997 25.35 27.925 46 22.875 24.45 25.8 26.875 47 22.25 25.374999999999996 25.45 26.924999999999997 48 23.705926481620406 23.25581395348837 24.706176544136035 28.33208302075519 49 23.9 24.675 24.675 26.75 50 23.0 23.65 27.400000000000002 25.95 51 23.474999999999998 22.775000000000002 25.1 28.65 52 23.075000000000003 24.375 25.025 27.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 2.0 19 3.0 20 2.5 21 2.0 22 2.0 23 2.0 24 4.0 25 6.0 26 7.5 27 9.0 28 16.0 29 23.0 30 31.5 31 40.0 32 48.5 33 57.0 34 59.5 35 62.0 36 74.0 37 86.0 38 116.5 39 151.5 40 156.0 41 175.5 42 195.0 43 236.0 44 277.0 45 318.5 46 360.0 47 365.5 48 371.0 49 380.0 50 389.0 51 394.5 52 400.0 53 392.5 54 385.0 55 342.5 56 300.0 57 278.5 58 257.0 59 214.0 60 171.0 61 141.5 62 112.0 63 79.5 64 44.5 65 42.0 66 41.0 67 40.0 68 29.0 69 18.0 70 16.5 71 15.0 72 15.0 73 15.0 74 10.0 75 5.0 76 4.5 77 4.0 78 3.5 79 3.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.79186228482003 92.77499999999999 2 2.477829942618675 4.75 3 0.4434011476264998 1.275 4 0.20865936358894105 0.8 5 0.05216484089723526 0.25 6 0.02608242044861763 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGG 6 0.15 No Hit GTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACGT 5 0.125 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra Read 200000 spots for SRR5423506.sra Written 200000 spots for SRR5423506.sra SRR ids: ['SRR5423506.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tlldwz69 SRR5423506.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423506 file size 703965 SRR5423506 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423506 SRR5423506_1.fastq Input file: SRR5423506_1.fastq trimmed: SRR5423506-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 11:49:56 2025 >> started Thu Feb 13 11:49:58 2025 >> done (2.017s) 4000000 reads processed; of these: 289 ( 0.01%) short reads filtered out after trimming by size control 167 ( 0.00%) empty reads filtered out after trimming by size control 3999544 (99.99%) reads available; of these: 66454 ( 1.66%) trimmed reads available after processing 3933090 (98.34%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 8 0.00% 20 7 0.00% 21 0 0.00% 22 2 0.00% 23 0 0.00% 24 0 0.00% 25 3 0.00% 26 5 0.00% 27 4 0.00% 28 14 0.00% 29 16 0.00% 30 22 0.00% 31 19 0.00% 32 33 0.00% 33 24 0.00% 34 15 0.00% 35 23 0.00% 36 46 0.00% 37 74 0.00% 38 61 0.00% 39 74 0.00% 40 89 0.00% 41 142 0.00% 42 112 0.00% 43 184 0.00% 44 241 0.01% 45 469 0.01% 46 683 0.02% 47 867 0.02% 48 1336 0.03% 49 2725 0.07% 50 7289 0.18% 51 51852 1.30% 52 3933090 98.34% 3999544 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.23 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=34.95 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.5 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 13 11:50:13 Started mapping on | Feb 13 11:50:14 Finished on | Feb 13 11:50:19 Mapping speed, Million of reads per hour | 2879.67 Number of input reads | 3999544 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3401387 Uniquely mapped reads % | 85.04% Average mapped length | 51.84 Number of splices: Total | 419129 Number of splices: Annotated (sjdb) | 414653 Number of splices: GT/AG | 411427 Number of splices: GC/AG | 7098 Number of splices: AT/AC | 222 Number of splices: Non-canonical | 382 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300455 % of reads mapped to multiple loci | 7.51% Number of reads mapped to too many loci | 283304 % of reads mapped to too many loci | 7.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.36% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 297702 297702 297702 N_multimapping 300455 300455 300455 N_noFeature 223378 3359295 239034 N_ambiguous 43368 33 16913 UnstrandedReadsAssigned:3134641 PositiveStrandReadsAssigned:42059 NegativeStrandReadsAssigned:3145440 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423506 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423506-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,544 reads, 3,466,056 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR5423506.ke.tsv 34699 SRR5423506.se.tsv 87100 total ==> SRR5423506.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 51 8.22069 Potri.005G024800.1.v4.1 1035 936 6 1.98284 Potri.004G059700.1.v4.1 961 862 16 5.7415 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 32.2091 3.50318 Potri.016G087400.1.v4.1 270 171 74 133.859 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 63 22.1952 ==> SRR5423506.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 58 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR5423506 completed mapping pipeline successfully