Starting /dee2/code/volunteer_pipeline.sh SRR5423507 current disk space = 3092444667904 free memory = 1454248200 SRR5423507 SRAfilesize 854d5d704c59613fe47c1dd32335dc11 SRR5423507.sra SRR5423507.sra file validated SRR5423507 is single end SRR5423507 is conventional basespace SRR5423507 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423507_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9455 33.0 31.0 34.0 30.0 34.0 2 32.1035 34.0 31.0 34.0 30.0 34.0 3 32.2845 34.0 31.0 34.0 30.0 34.0 4 35.342 37.0 35.0 37.0 32.0 37.0 5 35.70575 37.0 35.0 37.0 33.0 37.0 6 35.78 37.0 35.0 37.0 33.0 37.0 7 35.73125 37.0 35.0 37.0 33.0 37.0 8 35.72275 37.0 35.0 37.0 33.0 37.0 9 37.503 39.0 37.0 39.0 35.0 39.0 10 37.38025 39.0 37.0 39.0 34.0 39.0 11 37.2605 39.0 37.0 39.0 33.0 39.0 12 37.2895 39.0 37.0 39.0 34.0 39.0 13 37.17575 39.0 37.0 39.0 33.0 39.0 14 38.58275 40.0 38.0 41.0 34.0 41.0 15 38.48525 40.0 38.0 41.0 33.0 41.0 16 38.59675 40.0 38.0 41.0 34.0 41.0 17 38.60225 40.0 38.0 41.0 34.0 41.0 18 38.50425 40.0 38.0 41.0 34.0 41.0 19 38.47375 40.0 38.0 41.0 34.0 41.0 20 38.4115 40.0 38.0 41.0 34.0 41.0 21 38.5175 40.0 38.0 41.0 34.0 41.0 22 38.54825 40.0 38.0 41.0 34.0 41.0 23 38.5345 40.0 38.0 41.0 34.0 41.0 24 38.549 40.0 38.0 41.0 34.0 41.0 25 38.55425 40.0 38.0 41.0 34.0 41.0 26 38.56675 40.0 38.0 41.0 34.0 41.0 27 38.6845 40.0 38.0 41.0 34.0 41.0 28 38.4215 40.0 38.0 41.0 34.0 41.0 29 38.358 40.0 38.0 41.0 34.0 41.0 30 38.36925 40.0 38.0 41.0 34.0 41.0 31 38.234 40.0 38.0 41.0 33.0 41.0 32 38.28825 40.0 38.0 41.0 34.0 41.0 33 38.30575 40.0 38.0 41.0 34.0 41.0 34 38.3165 40.0 38.0 41.0 33.0 41.0 35 38.22775 40.0 38.0 41.0 34.0 41.0 36 38.18875 40.0 38.0 41.0 33.0 41.0 37 38.25425 40.0 38.0 41.0 33.0 41.0 38 38.08625 40.0 38.0 41.0 33.0 41.0 39 37.97475 40.0 37.0 41.0 33.0 41.0 40 37.858 40.0 37.0 41.0 33.0 41.0 41 37.77825 40.0 37.0 41.0 32.0 41.0 42 37.7995 40.0 37.0 41.0 33.0 41.0 43 37.68225 40.0 37.0 41.0 32.0 41.0 44 37.7095 40.0 37.0 41.0 32.0 41.0 45 37.6285 40.0 37.0 41.0 33.0 41.0 46 37.51975 40.0 37.0 41.0 32.0 41.0 47 37.51625 40.0 36.0 41.0 32.0 41.0 48 37.44825 40.0 36.0 41.0 32.0 41.0 49 37.2395 39.0 36.0 41.0 31.0 41.0 50 37.0935 39.0 36.0 41.0 31.0 41.0 51 37.15725 39.0 36.0 41.0 31.0 41.0 52 36.05825 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1311 1 0.0 1311 2 0.0 1311 3 0.0 1311 4 0.0 1311 5 0.0 1311 6 0.0 1311 7 0.0 1311 8 0.0 1311 9 0.0 1311 10 0.0 1311 11 0.0 1311 12 0.0 1311 13 0.0 1311 14 0.0 1311 15 0.0 1311 16 0.0 1311 17 0.0 1311 18 0.0 1311 19 0.0 1311 20 0.0 1311 21 0.0 1311 22 0.0 1311 23 0.0 1311 24 0.0 1311 25 0.0 1311 26 0.0 1311 27 0.0 1311 28 0.0 1311 29 0.0 1311 30 0.0 1311 31 0.0 1311 32 0.0 1311 33 0.0 1311 34 0.0 1311 35 0.0 1311 36 0.0 1311 37 0.0 1311 38 0.0 1311 39 0.0 1311 40 0.0 1311 41 0.0 1311 42 0.0 1311 43 0.0 1311 44 0.0 1311 45 0.0 1311 46 0.0 1311 47 0.0 1311 48 0.0 1311 49 0.0 1311 50 0.0 1311 51 0.0 1311 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 5.0 23 5.0 24 3.0 25 9.0 26 9.0 27 18.0 28 41.0 29 41.0 30 56.0 31 73.0 32 103.0 33 110.0 34 182.0 35 229.0 36 324.0 37 391.0 38 744.0 39 1648.0 40 7.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.50564051140637 13.863123589872147 5.5903735271998 33.04086237152168 2 23.25 16.45 34.225 26.075 3 19.525000000000002 21.4 26.525 32.550000000000004 4 24.65 29.099999999999998 21.975 24.275 5 22.85 33.225 23.775 20.150000000000002 6 19.825 31.3 23.75 25.124999999999996 7 16.85 21.025 40.375 21.75 8 19.125 19.925 30.975 29.975 9 19.400000000000002 19.625 31.8 29.175 10 20.599999999999998 35.675000000000004 23.525 20.200000000000003 11 25.7 24.9 20.1 29.299999999999997 12 22.525000000000002 21.4 25.775 30.3 13 21.3 25.424999999999997 27.375 25.900000000000002 14 22.2 25.674999999999997 26.575 25.55 15 21.8 24.3 26.650000000000002 27.250000000000004 16 23.5 24.675 25.674999999999997 26.150000000000002 17 22.375 25.074999999999996 26.200000000000003 26.35 18 22.725 24.099999999999998 26.3 26.875 19 24.025 24.4 25.575 26.0 20 22.0 25.275 26.775 25.95 21 22.775000000000002 24.5 26.5 26.224999999999998 22 24.15 24.15 24.75 26.950000000000003 23 22.900000000000002 24.3 26.55 26.25 24 22.875 23.075000000000003 26.174999999999997 27.875 25 21.95 23.549999999999997 26.05 28.449999999999996 26 22.35 25.074999999999996 26.35 26.224999999999998 27 23.375 25.1 25.900000000000002 25.624999999999996 28 22.025 25.724999999999998 26.5 25.75 29 24.15 25.75 24.474999999999998 25.624999999999996 30 22.125 24.525 26.025 27.325 31 23.3 25.624999999999996 24.8 26.275 32 24.575 23.925 24.875 26.625 33 23.150000000000002 24.099999999999998 25.7 27.05 34 23.1 25.05 24.875 26.974999999999998 35 23.175 23.849999999999998 25.5 27.474999999999998 36 22.25 25.025 25.525 27.200000000000003 37 22.6 24.025 25.900000000000002 27.474999999999998 38 22.825 25.724999999999998 25.7 25.75 39 23.5 22.925 25.8 27.775 40 23.200000000000003 25.05 24.275 27.474999999999998 41 22.3 24.6 26.25 26.85 42 23.025000000000002 24.075 26.075 26.825 43 23.95 23.7 25.324999999999996 27.025 44 23.05 24.6 25.7 26.650000000000002 45 22.95 23.825 25.6 27.625 46 23.75 24.65 25.924999999999997 25.674999999999997 47 24.05 23.45 26.525 25.974999999999998 48 23.075000000000003 23.225 25.75 27.950000000000003 49 24.0 24.125 25.025 26.85 50 22.400000000000002 24.25 26.174999999999997 27.175 51 22.5 23.625 25.3 28.575 52 24.2 24.075 24.0 27.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 2.0 21 2.0 22 4.5 23 7.0 24 8.0 25 9.0 26 9.5 27 10.0 28 17.5 29 25.0 30 26.5 31 28.0 32 40.0 33 52.0 34 55.5 35 59.0 36 81.0 37 103.0 38 111.0 39 148.0 40 177.0 41 191.0 42 205.0 43 234.0 44 263.0 45 292.5 46 322.0 47 336.0 48 350.0 49 359.5 50 369.0 51 376.5 52 384.0 53 404.5 54 425.0 55 371.5 56 318.0 57 280.5 58 243.0 59 220.5 60 198.0 61 171.5 62 145.0 63 105.0 64 54.0 65 43.0 66 31.5 67 20.0 68 18.0 69 16.0 70 16.5 71 17.0 72 14.0 73 11.0 74 9.0 75 7.0 76 5.5 77 4.0 78 2.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.0 #Duplication Level Percentage of deduplicated Percentage of total 1 96.84895833333333 92.975 2 2.65625 5.1 3 0.26041666666666663 0.75 4 0.13020833333333331 0.5 5 0.026041666666666668 0.125 6 0.026041666666666668 0.15 7 0.026041666666666668 0.17500000000000002 8 0.0 0.0 9 0.026041666666666668 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 9 0.22499999999999998 No Hit GTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAAT 7 0.17500000000000002 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 6 0.15 No Hit GGGAAAGCTGAGGTAGACTTGAGGCCGTTGAATGGTGCAACCATGTTGGCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra Read 200000 spots for SRR5423507.sra Written 200000 spots for SRR5423507.sra SRR ids: ['SRR5423507.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dvrbd3e8 SRR5423507.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423507 file size 703982 SRR5423507 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423507 SRR5423507_1.fastq Input file: SRR5423507_1.fastq trimmed: SRR5423507-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:16:28 2025 >> started Thu Feb 13 12:16:30 2025 >> done (2.067s) 4000000 reads processed; of these: 243 ( 0.01%) short reads filtered out after trimming by size control 186 ( 0.00%) empty reads filtered out after trimming by size control 3999571 (99.99%) reads available; of these: 61045 ( 1.53%) trimmed reads available after processing 3938526 (98.47%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 10 0.00% 20 10 0.00% 21 1 0.00% 22 0 0.00% 23 2 0.00% 24 0 0.00% 25 2 0.00% 26 6 0.00% 27 5 0.00% 28 14 0.00% 29 10 0.00% 30 13 0.00% 31 17 0.00% 32 27 0.00% 33 20 0.00% 34 20 0.00% 35 30 0.00% 36 39 0.00% 37 72 0.00% 38 58 0.00% 39 57 0.00% 40 110 0.00% 41 136 0.00% 42 131 0.00% 43 187 0.00% 44 261 0.01% 45 415 0.01% 46 613 0.02% 47 769 0.02% 48 1180 0.03% 49 2530 0.06% 50 6731 0.17% 51 47550 1.19% 52 3938526 98.47% 3999571 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=0.24 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=24.87 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.6 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 13 12:16:44 Started mapping on | Feb 13 12:16:44 Finished on | Feb 13 12:16:49 Mapping speed, Million of reads per hour | 2879.69 Number of input reads | 3999571 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3401587 Uniquely mapped reads % | 85.05% Average mapped length | 51.85 Number of splices: Total | 419434 Number of splices: Annotated (sjdb) | 414944 Number of splices: GT/AG | 411696 Number of splices: GC/AG | 7108 Number of splices: AT/AC | 227 Number of splices: Non-canonical | 403 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.54 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300232 % of reads mapped to multiple loci | 7.51% Number of reads mapped to too many loci | 283710 % of reads mapped to too many loci | 7.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.35% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 297752 297752 297752 N_multimapping 300232 300232 300232 N_noFeature 225085 3359682 240741 N_ambiguous 43357 32 17086 UnstrandedReadsAssigned:3133145 PositiveStrandReadsAssigned:41873 NegativeStrandReadsAssigned:3143760 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423507 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423507-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,571 reads, 3,465,151 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 SRR5423507.ke.tsv 34699 SRR5423507.se.tsv 87100 total ==> SRR5423507.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 61 9.83871 Potri.005G024800.1.v4.1 1035 936 9 2.97612 Potri.004G059700.1.v4.1 961 862 7 2.51347 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 43 4.67975 Potri.016G087400.1.v4.1 270 171 79 142.993 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 48 16.9212 ==> SRR5423507.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 41 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423507 completed mapping pipeline successfully