Starting /dee2/code/volunteer_pipeline.sh SRR5423508 current disk space = 3052033134592 free memory = 1502624408 SRR5423508 SRAfilesize ff3fb859247cf829c16737386e5f34fc SRR5423508.sra SRR5423508.sra file validated SRR5423508 is single end SRR5423508 is conventional basespace SRR5423508 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423508_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.218 34.0 31.0 34.0 30.0 34.0 2 32.4405 34.0 31.0 34.0 30.0 34.0 3 32.606 34.0 31.0 34.0 30.0 34.0 4 35.46925 37.0 35.0 37.0 33.0 37.0 5 35.91925 37.0 35.0 37.0 35.0 37.0 6 35.969 37.0 35.0 37.0 35.0 37.0 7 36.077 37.0 35.0 37.0 35.0 37.0 8 36.06225 37.0 35.0 37.0 35.0 37.0 9 37.70475 39.0 37.0 39.0 35.0 39.0 10 37.67075 39.0 37.0 39.0 35.0 39.0 11 37.78325 39.0 37.0 39.0 35.0 39.0 12 37.6965 39.0 37.0 39.0 35.0 39.0 13 37.63175 39.0 37.0 39.0 35.0 39.0 14 39.01825 40.0 38.0 41.0 36.0 41.0 15 39.0395 40.0 38.0 41.0 36.0 41.0 16 38.9385 40.0 38.0 41.0 36.0 41.0 17 38.894 40.0 38.0 41.0 36.0 41.0 18 39.0105 40.0 38.0 41.0 36.0 41.0 19 39.04375 40.0 39.0 41.0 36.0 41.0 20 38.982 40.0 38.0 41.0 35.0 41.0 21 39.07075 40.0 39.0 41.0 36.0 41.0 22 39.027 40.0 39.0 41.0 36.0 41.0 23 38.97 40.0 38.0 41.0 35.0 41.0 24 39.047 40.0 38.0 41.0 35.0 41.0 25 39.011 40.0 38.0 41.0 36.0 41.0 26 38.82425 40.0 38.0 41.0 35.0 41.0 27 38.7535 40.0 38.0 41.0 35.0 41.0 28 38.67475 40.0 38.0 41.0 34.0 41.0 29 38.674 40.0 38.0 41.0 35.0 41.0 30 38.8245 40.0 38.0 41.0 35.0 41.0 31 38.75975 40.0 38.0 41.0 35.0 41.0 32 38.673 40.0 38.0 41.0 35.0 41.0 33 38.63025 40.0 38.0 41.0 35.0 41.0 34 38.594 40.0 38.0 41.0 34.0 41.0 35 38.4945 40.0 38.0 41.0 34.0 41.0 36 38.6105 40.0 38.0 41.0 34.0 41.0 37 38.4025 40.0 38.0 41.0 34.0 41.0 38 38.318 40.0 38.0 41.0 33.0 41.0 39 38.38475 40.0 38.0 41.0 34.0 41.0 40 38.38625 40.0 38.0 41.0 34.0 41.0 41 38.40575 40.0 38.0 41.0 34.0 41.0 42 38.25425 40.0 38.0 41.0 33.0 41.0 43 38.061 40.0 37.0 41.0 33.0 41.0 44 38.0045 40.0 37.0 41.0 33.0 41.0 45 37.91075 40.0 37.0 41.0 33.0 41.0 46 38.04575 40.0 37.0 41.0 33.0 41.0 47 37.7815 40.0 37.0 41.0 33.0 41.0 48 37.76825 40.0 37.0 41.0 33.0 41.0 49 37.8085 40.0 37.0 41.0 33.0 41.0 50 37.70775 40.0 37.0 41.0 33.0 41.0 51 37.5735 40.0 36.0 41.0 32.0 41.0 52 36.768 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2109 1 0.0 2109 2 0.0 2109 3 0.0 2109 4 0.0 2109 5 0.0 2109 6 0.0 2109 7 0.0 2109 8 0.0 2109 9 0.0 2109 10 0.0 2109 11 0.0 2109 12 0.0 2109 13 0.0 2109 14 0.0 2109 15 0.0 2109 16 0.0 2109 17 0.0 2109 18 0.0 2109 19 0.0 2109 20 0.0 2109 21 0.0 2109 22 0.0 2109 23 0.0 2109 24 0.0 2109 25 0.0 2109 26 0.0 2109 27 0.0 2109 28 0.0 2109 29 0.0 2109 30 0.0 2109 31 0.0 2109 32 0.0 2109 33 0.0 2109 34 0.0 2109 35 0.0 2109 36 0.0 2109 37 0.0 2109 38 0.0 2109 39 0.0 2109 40 0.0 2109 41 0.0 2109 42 0.0 2109 43 0.0 2109 44 0.0 2109 45 0.0 2109 46 0.0 2109 47 0.0 2109 48 0.0 2109 49 0.0 2109 50 0.0 2109 51 0.0 2109 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 4.0 24 3.0 25 8.0 26 10.0 27 9.0 28 14.0 29 32.0 30 49.0 31 57.0 32 78.0 33 112.0 34 130.0 35 190.0 36 264.0 37 434.0 38 730.0 39 1867.0 40 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.18432256448785 13.974455296769348 4.983721512647133 32.857500626095664 2 23.65 14.95 34.325 27.075 3 19.775000000000002 21.4 25.974999999999998 32.85 4 24.625 29.25 21.825 24.3 5 23.0 34.0 22.175 20.825 6 19.15 32.625 25.174999999999997 23.05 7 16.5 20.525 41.175 21.8 8 19.400000000000002 19.375 30.2 31.025000000000002 9 18.675 19.425 33.5 28.4 10 20.175 35.425000000000004 23.35 21.05 11 25.900000000000002 24.575 19.1 30.425 12 22.1 22.1 25.775 30.025000000000002 13 20.65 24.725 27.950000000000003 26.674999999999997 14 21.3 24.725 26.525 27.450000000000003 15 22.325 24.975 26.025 26.674999999999997 16 23.375 25.674999999999997 25.775 25.174999999999997 17 21.775 23.75 26.950000000000003 27.525 18 22.375 23.799999999999997 25.575 28.249999999999996 19 23.75 24.325 26.674999999999997 25.25 20 23.05 23.9 26.55 26.5 21 21.65 25.15 26.275 26.924999999999997 22 24.5 24.224999999999998 25.575 25.7 23 21.875 25.6 25.95 26.575 24 21.85 24.65 26.05 27.450000000000003 25 23.45 23.849999999999998 25.7 27.0 26 22.5 23.7 26.650000000000002 27.150000000000002 27 21.175 25.0 26.174999999999997 27.650000000000002 28 23.325000000000003 25.124999999999996 25.8 25.75 29 23.875 23.775 25.874999999999996 26.474999999999998 30 21.975 23.974999999999998 26.924999999999997 27.125 31 23.825 25.424999999999997 24.425 26.325 32 24.525 24.0 25.7 25.775 33 21.575 24.275 26.625 27.525 34 22.2 25.7 26.150000000000002 25.95 35 22.7 23.25 26.1 27.950000000000003 36 23.075000000000003 24.45 25.174999999999997 27.3 37 23.674999999999997 24.725 25.5 26.1 38 23.200000000000003 22.725 26.35 27.725 39 21.15 24.025 26.700000000000003 28.125 40 23.150000000000002 26.375 24.95 25.525 41 23.45 24.125 25.85 26.575 42 23.549999999999997 24.925 24.65 26.875 43 23.5 25.35 24.5 26.650000000000002 44 23.575 24.125 26.75 25.55 45 21.925 23.9 27.250000000000004 26.924999999999997 46 23.674999999999997 24.55 25.724999999999998 26.05 47 23.75 24.65 26.400000000000002 25.2 48 22.25 24.275 24.875 28.599999999999998 49 23.400000000000002 23.825 26.5 26.275 50 23.425 23.849999999999998 25.75 26.974999999999998 51 23.125 23.1 25.424999999999997 28.349999999999998 52 24.825 22.875 24.95 27.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 1.5 19 3.0 20 3.0 21 3.0 22 2.0 23 1.0 24 4.0 25 7.0 26 9.5 27 12.0 28 14.0 29 16.0 30 25.0 31 34.0 32 38.5 33 43.0 34 56.5 35 70.0 36 85.0 37 100.0 38 112.5 39 158.0 40 191.0 41 198.5 42 206.0 43 249.0 44 292.0 45 317.0 46 342.0 47 353.0 48 364.0 49 370.5 50 377.0 51 368.5 52 360.0 53 358.0 54 356.0 55 337.5 56 319.0 57 298.5 58 278.0 59 229.0 60 180.0 61 154.5 62 129.0 63 89.5 64 44.0 65 38.0 66 35.5 67 33.0 68 27.0 69 21.0 70 18.5 71 16.0 72 18.5 73 21.0 74 12.0 75 3.0 76 4.0 77 5.0 78 4.0 79 3.0 80 2.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.15 #Duplication Level Percentage of deduplicated Percentage of total 1 97.03588143525741 93.30000000000001 2 2.3660946437857513 4.55 3 0.41601664066562666 1.2 4 0.05200208008320333 0.2 5 0.078003120124805 0.375 6 0.0 0.0 7 0.026001040041601666 0.17500000000000002 8 0.026001040041601666 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 8 0.2 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 7 0.17500000000000002 No Hit GTTCTTGGCAAAGGTCTCTGGGTCAGCAGAGAGGCCAGCAGTGTCCCAGCCG 5 0.125 No Hit GGGAAACTTCGGAGGGAACCAGCTACTAGACGGTTCGATTAGTCTTTCGCCC 5 0.125 No Hit GTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra Read 200000 spots for SRR5423508.sra Written 200000 spots for SRR5423508.sra SRR ids: ['SRR5423508.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4bylntps SRR5423508.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423508 file size 703988 SRR5423508 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423508 SRR5423508_1.fastq Input file: SRR5423508_1.fastq trimmed: SRR5423508-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 16:23:59 2025 >> started Wed Feb 12 16:24:01 2025 >> done (1.455s) 4000000 reads processed; of these: 222 ( 0.01%) short reads filtered out after trimming by size control 191 ( 0.00%) empty reads filtered out after trimming by size control 3999587 (99.99%) reads available; of these: 68364 ( 1.71%) trimmed reads available after processing 3931223 (98.29%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 8 0.00% 20 7 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 9 0.00% 26 4 0.00% 27 7 0.00% 28 12 0.00% 29 25 0.00% 30 13 0.00% 31 34 0.00% 32 53 0.00% 33 31 0.00% 34 33 0.00% 35 31 0.00% 36 47 0.00% 37 82 0.00% 38 77 0.00% 39 76 0.00% 40 120 0.00% 41 171 0.00% 42 183 0.00% 43 254 0.01% 44 318 0.01% 45 523 0.01% 46 759 0.02% 47 959 0.02% 48 1633 0.04% 49 3197 0.08% 50 8222 0.21% 51 51461 1.29% 52 3931223 98.29% 3999587 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.24 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=22.96 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.7 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 12 16:24:14 Started mapping on | Feb 12 16:24:14 Finished on | Feb 12 16:24:19 Mapping speed, Million of reads per hour | 2879.70 Number of input reads | 3999587 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3402467 Uniquely mapped reads % | 85.07% Average mapped length | 51.83 Number of splices: Total | 417863 Number of splices: Annotated (sjdb) | 413421 Number of splices: GT/AG | 410238 Number of splices: GC/AG | 7006 Number of splices: AT/AC | 208 Number of splices: Non-canonical | 411 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300549 % of reads mapped to multiple loci | 7.51% Number of reads mapped to too many loci | 281540 % of reads mapped to too many loci | 7.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.37% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 296571 296571 296571 N_multimapping 300549 300549 300549 N_noFeature 223881 3360387 239613 N_ambiguous 43225 32 16857 UnstrandedReadsAssigned:3135361 PositiveStrandReadsAssigned:42048 NegativeStrandReadsAssigned:3145997 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423508 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423508-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,587 reads, 3,455,516 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR5423508.ke.tsv 34699 SRR5423508.se.tsv 87100 total ==> SRR5423508.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 54 8.72764 Potri.005G024800.1.v4.1 1035 936 4.0043 1.32687 Potri.004G059700.1.v4.1 961 862 6 2.15885 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 41.2261 4.49594 Potri.016G087400.1.v4.1 270 171 88 159.612 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 76 26.8471 ==> SRR5423508.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 62 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR5423508 completed mapping pipeline successfully