Starting /dee2/code/volunteer_pipeline.sh SRR5423509 current disk space = 3052030976000 free memory = 1521373396 SRR5423509 SRAfilesize c7b9d59cc626d1071fc6df809f958950 SRR5423509.sra SRR5423509.sra file validated SRR5423509 is single end SRR5423509 is conventional basespace SRR5423509 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423509_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.47825 34.0 31.0 34.0 30.0 34.0 2 32.523 34.0 31.0 34.0 30.0 34.0 3 32.63125 34.0 31.0 34.0 31.0 34.0 4 35.986 37.0 35.0 37.0 35.0 37.0 5 36.02925 37.0 35.0 37.0 35.0 37.0 6 35.9655 37.0 35.0 37.0 35.0 37.0 7 36.02625 37.0 35.0 37.0 35.0 37.0 8 36.00075 37.0 35.0 37.0 35.0 37.0 9 37.64475 39.0 38.0 39.0 35.0 39.0 10 37.6445 39.0 38.0 39.0 35.0 39.0 11 37.785 39.0 38.0 39.0 35.0 39.0 12 37.689 39.0 38.0 39.0 35.0 39.0 13 37.76725 39.0 38.0 39.0 35.0 39.0 14 39.10475 40.0 39.0 41.0 36.0 41.0 15 39.003 40.0 38.0 41.0 36.0 41.0 16 38.9355 40.0 38.0 41.0 35.0 41.0 17 39.04075 40.0 38.0 41.0 36.0 41.0 18 38.92075 40.0 38.0 41.0 35.0 41.0 19 39.02275 40.0 39.0 41.0 36.0 41.0 20 38.968 40.0 39.0 41.0 35.0 41.0 21 38.903 40.0 39.0 41.0 35.0 41.0 22 38.9935 40.0 39.0 41.0 35.0 41.0 23 38.86 40.0 38.0 41.0 35.0 41.0 24 38.87125 40.0 38.0 41.0 35.0 41.0 25 38.84025 40.0 38.0 41.0 35.0 41.0 26 38.77275 40.0 38.0 41.0 35.0 41.0 27 38.6625 40.0 38.0 41.0 34.0 41.0 28 38.6895 40.0 38.0 41.0 34.0 41.0 29 38.572 40.0 38.0 41.0 34.0 41.0 30 38.52 40.0 38.0 41.0 34.0 41.0 31 38.655 40.0 38.0 41.0 34.0 41.0 32 38.60925 40.0 38.0 41.0 34.0 41.0 33 38.54625 40.0 38.0 41.0 34.0 41.0 34 38.42925 40.0 38.0 41.0 34.0 41.0 35 38.1595 40.0 38.0 41.0 33.0 41.0 36 38.232 40.0 38.0 41.0 33.0 41.0 37 38.26 40.0 38.0 41.0 33.0 41.0 38 38.19275 40.0 38.0 41.0 33.0 41.0 39 38.20275 40.0 38.0 41.0 33.0 41.0 40 38.128 40.0 38.0 41.0 33.0 41.0 41 38.04625 40.0 38.0 41.0 33.0 41.0 42 37.9305 40.0 38.0 41.0 32.0 41.0 43 37.99825 40.0 38.0 41.0 33.0 41.0 44 37.77925 40.0 37.0 41.0 32.0 41.0 45 37.664 40.0 37.0 41.0 32.0 41.0 46 37.6045 40.0 37.0 41.0 31.0 41.0 47 37.63025 40.0 37.0 41.0 32.0 41.0 48 37.55775 40.0 37.0 41.0 32.0 41.0 49 37.40375 40.0 37.0 41.0 31.0 41.0 50 37.37675 40.0 37.0 41.0 31.0 41.0 51 37.50825 40.0 37.0 41.0 32.0 41.0 52 35.95525 38.0 35.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2207 1 0.0 2207 2 0.0 2207 3 0.0 2207 4 0.0 2207 5 0.0 2207 6 0.0 2207 7 0.0 2207 8 0.0 2207 9 0.0 2207 10 0.0 2207 11 0.0 2207 12 0.0 2207 13 0.0 2207 14 0.0 2207 15 0.0 2207 16 0.0 2207 17 0.0 2207 18 0.0 2207 19 0.0 2207 20 0.0 2207 21 0.0 2207 22 0.0 2207 23 0.0 2207 24 0.0 2207 25 0.0 2207 26 0.0 2207 27 0.0 2207 28 0.0 2207 29 0.0 2207 30 0.0 2207 31 0.0 2207 32 0.0 2207 33 0.0 2207 34 0.0 2207 35 0.0 2207 36 0.0 2207 37 0.0 2207 38 0.0 2207 39 0.0 2207 40 0.0 2207 41 0.0 2207 42 0.0 2207 43 0.0 2207 44 0.0 2207 45 0.0 2207 46 0.0 2207 47 0.0 2207 48 0.0 2207 49 0.0 2207 50 0.0 2207 51 0.0 2207 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 5.0 22 3.0 23 6.0 24 9.0 25 7.0 26 9.0 27 17.0 28 33.0 29 39.0 30 54.0 31 64.0 32 69.0 33 109.0 34 152.0 35 174.0 36 241.0 37 357.0 38 708.0 39 1935.0 40 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.22233350025037 13.845768652979471 5.958938407611417 31.97295943915874 2 22.575 15.5 34.925 27.0 3 18.525 21.45 28.425 31.6 4 24.125 30.025000000000002 22.025 23.825 5 23.575 33.300000000000004 21.45 21.675 6 19.85 32.775 22.525000000000002 24.85 7 16.825000000000003 21.425 41.65 20.1 8 19.15 19.35 29.875 31.624999999999996 9 18.525 20.225 32.1 29.15 10 19.8 36.025 23.325000000000003 20.849999999999998 11 24.7 25.85 19.025 30.425 12 23.175 21.95 24.85 30.025000000000002 13 20.225 25.15 27.725 26.900000000000002 14 19.925 24.85 28.199999999999996 27.025 15 21.775 23.974999999999998 26.6 27.650000000000002 16 22.475 24.6 26.325 26.6 17 23.25 25.174999999999997 25.474999999999998 26.1 18 21.9 23.724999999999998 26.5 27.875 19 20.875 26.8 26.35 25.974999999999998 20 23.025000000000002 25.124999999999996 25.074999999999996 26.775 21 22.900000000000002 23.799999999999997 26.224999999999998 27.075 22 22.45 24.725 25.45 27.375 23 22.7 25.3 25.424999999999997 26.575 24 21.425 24.45 27.125 27.0 25 22.2 24.425 25.525 27.85 26 23.474999999999998 23.45 27.025 26.05 27 21.9 24.15 27.150000000000002 26.8 28 22.1 26.125 25.650000000000002 26.125 29 21.525 26.125 25.0 27.35 30 21.3 25.4 26.1 27.200000000000003 31 23.35 25.974999999999998 24.075 26.6 32 22.375 24.575 25.75 27.3 33 22.075 24.925 25.95 27.05 34 21.9 23.775 26.950000000000003 27.375 35 22.0 24.349999999999998 26.5 27.150000000000002 36 22.400000000000002 24.5 26.200000000000003 26.900000000000002 37 22.3 24.875 25.825 27.0 38 21.775 23.549999999999997 27.05 27.625 39 22.650000000000002 24.375 24.825 28.15 40 21.875 24.975 25.900000000000002 27.250000000000004 41 22.900000000000002 24.5 25.25 27.35 42 22.925 23.674999999999997 25.474999999999998 27.925 43 22.825 24.099999999999998 26.5 26.575 44 22.125 23.825 26.55 27.500000000000004 45 23.400000000000002 24.05 24.975 27.575 46 23.625 25.324999999999996 24.675 26.375 47 22.825 24.775 26.224999999999998 26.174999999999997 48 23.025000000000002 24.125 24.75 28.1 49 23.7 23.974999999999998 24.95 27.375 50 22.15 24.775 26.825 26.25 51 22.875 23.7 25.724999999999998 27.700000000000003 52 23.849999999999998 23.674999999999997 25.8 26.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 3.0 18 3.0 19 3.0 20 3.5 21 4.0 22 4.5 23 5.0 24 6.0 25 7.0 26 7.5 27 8.0 28 16.0 29 24.0 30 27.0 31 30.0 32 41.5 33 53.0 34 65.5 35 78.0 36 91.0 37 104.0 38 119.0 39 160.5 40 187.0 41 207.0 42 227.0 43 257.0 44 287.0 45 289.5 46 292.0 47 331.0 48 370.0 49 368.5 50 367.0 51 384.5 52 402.0 53 376.0 54 350.0 55 345.0 56 340.0 57 295.0 58 250.0 59 215.5 60 181.0 61 143.5 62 106.0 63 74.5 64 43.5 65 44.0 66 39.0 67 34.0 68 25.0 69 16.0 70 18.0 71 20.0 72 15.5 73 11.0 74 9.5 75 8.0 76 6.5 77 5.0 78 4.0 79 3.0 80 3.5 81 4.0 82 2.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.76746611053181 92.80000000000001 2 2.5808133472367047 4.95 3 0.4171011470281543 1.2 4 0.15641293013555788 0.6 5 0.026068821689259645 0.125 6 0.026068821689259645 0.15 7 0.026068821689259645 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGG 7 0.17500000000000002 No Hit GGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAA 6 0.15 No Hit GCCTCCTCAAGCTCAAGCAACACTTGAGATGCCTCAGTGCATCCAAACATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra Read 200000 spots for SRR5423509.sra Written 200000 spots for SRR5423509.sra SRR ids: ['SRR5423509.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c0o7d9vs SRR5423509.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423509 file size 703978 SRR5423509 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423509 SRR5423509_1.fastq Input file: SRR5423509_1.fastq trimmed: SRR5423509-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 16:24:47 2025 >> started Wed Feb 12 16:24:49 2025 >> done (1.963s) 4000000 reads processed; of these: 281 ( 0.01%) short reads filtered out after trimming by size control 158 ( 0.00%) empty reads filtered out after trimming by size control 3999561 (99.99%) reads available; of these: 66681 ( 1.67%) trimmed reads available after processing 3932880 (98.33%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 10 0.00% 20 13 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 3 0.00% 25 5 0.00% 26 5 0.00% 27 7 0.00% 28 14 0.00% 29 13 0.00% 30 16 0.00% 31 23 0.00% 32 31 0.00% 33 32 0.00% 34 25 0.00% 35 19 0.00% 36 31 0.00% 37 55 0.00% 38 82 0.00% 39 65 0.00% 40 100 0.00% 41 175 0.00% 42 156 0.00% 43 222 0.01% 44 281 0.01% 45 537 0.01% 46 767 0.02% 47 889 0.02% 48 1431 0.04% 49 3029 0.08% 50 7643 0.19% 51 50974 1.27% 52 3932880 98.33% 3999561 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.24 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=35.17 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.3 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 12 16:24:59 Started mapping on | Feb 12 16:24:59 Finished on | Feb 12 16:25:04 Mapping speed, Million of reads per hour | 2879.68 Number of input reads | 3999561 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3405900 Uniquely mapped reads % | 85.16% Average mapped length | 51.84 Number of splices: Total | 419602 Number of splices: Annotated (sjdb) | 415110 Number of splices: GT/AG | 411713 Number of splices: GC/AG | 7266 Number of splices: AT/AC | 225 Number of splices: Non-canonical | 398 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 1.57 Insertion rate per base | 0.00% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299729 % of reads mapped to multiple loci | 7.49% Number of reads mapped to too many loci | 279392 % of reads mapped to too many loci | 6.99% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.36% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 293932 293932 293932 N_multimapping 299729 299729 299729 N_noFeature 224360 3364064 239877 N_ambiguous 43261 34 16926 UnstrandedReadsAssigned:3138279 PositiveStrandReadsAssigned:41802 NegativeStrandReadsAssigned:3149097 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423509 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423509-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,561 reads, 3,458,916 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,030 rounds 52401 SRR5423509.ke.tsv 34699 SRR5423509.se.tsv 87100 total ==> SRR5423509.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 50 8.08866 Potri.005G024800.1.v4.1 1035 936 7 2.32169 Potri.004G059700.1.v4.1 961 862 9 3.24128 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 30 3.27471 Potri.016G087400.1.v4.1 270 171 95.9302 174.157 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 73 25.8113 ==> SRR5423509.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 59 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR5423509 completed mapping pipeline successfully