Starting /dee2/code/volunteer_pipeline.sh SRR5423510 current disk space = 3051977625600 free memory = 1579040056 SRR5423510 SRAfilesize 0a62cc4deab921711a9e933e79c1eebd SRR5423510.sra SRR5423510.sra file validated SRR5423510 is single end SRR5423510 is conventional basespace SRR5423510 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423510_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5835 34.0 31.0 34.0 31.0 34.0 2 32.66025 34.0 31.0 34.0 31.0 34.0 3 32.714 34.0 31.0 34.0 31.0 34.0 4 36.15 37.0 37.0 37.0 35.0 37.0 5 36.056 37.0 35.0 37.0 35.0 37.0 6 36.10075 37.0 36.0 37.0 35.0 37.0 7 36.02725 37.0 36.0 37.0 35.0 37.0 8 36.05875 37.0 35.0 37.0 35.0 37.0 9 37.88025 39.0 38.0 39.0 35.0 39.0 10 37.82925 39.0 38.0 39.0 35.0 39.0 11 37.735 39.0 38.0 39.0 35.0 39.0 12 37.78625 39.0 38.0 39.0 35.0 39.0 13 37.7075 39.0 38.0 39.0 35.0 39.0 14 39.31125 41.0 39.0 41.0 36.0 41.0 15 39.22225 41.0 39.0 41.0 36.0 41.0 16 39.085 40.0 38.0 41.0 36.0 41.0 17 39.136 40.0 39.0 41.0 36.0 41.0 18 39.06375 40.0 38.0 41.0 36.0 41.0 19 38.99125 40.0 39.0 41.0 35.0 41.0 20 39.0915 40.0 39.0 41.0 36.0 41.0 21 39.11025 40.0 39.0 41.0 36.0 41.0 22 39.04125 40.0 39.0 41.0 36.0 41.0 23 38.92 40.0 38.0 41.0 35.0 41.0 24 39.044 40.0 39.0 41.0 35.0 41.0 25 38.99875 40.0 39.0 41.0 36.0 41.0 26 38.7125 40.0 38.0 41.0 35.0 41.0 27 38.78675 40.0 39.0 41.0 35.0 41.0 28 38.85025 40.0 38.0 41.0 35.0 41.0 29 38.8395 40.0 39.0 41.0 35.0 41.0 30 38.78075 40.0 38.0 41.0 35.0 41.0 31 38.75675 40.0 38.0 41.0 35.0 41.0 32 38.8045 40.0 38.0 41.0 35.0 41.0 33 38.80225 40.0 38.0 41.0 35.0 41.0 34 38.65225 40.0 38.0 41.0 34.0 41.0 35 38.64975 40.0 38.0 41.0 35.0 41.0 36 38.488 40.0 38.0 41.0 34.0 41.0 37 38.44425 40.0 38.0 41.0 34.0 41.0 38 38.3755 40.0 38.0 41.0 34.0 41.0 39 38.28925 40.0 38.0 41.0 33.0 41.0 40 38.30275 40.0 38.0 41.0 33.0 41.0 41 38.21875 40.0 38.0 41.0 33.0 41.0 42 38.121 40.0 38.0 41.0 33.0 41.0 43 38.0345 40.0 38.0 41.0 33.0 41.0 44 37.887 40.0 37.0 41.0 33.0 41.0 45 37.8955 40.0 37.0 41.0 33.0 41.0 46 37.91625 40.0 37.0 41.0 33.0 41.0 47 37.78775 40.0 37.0 41.0 33.0 41.0 48 37.6295 40.0 37.0 41.0 33.0 41.0 49 37.55 40.0 37.0 41.0 32.0 41.0 50 37.51475 40.0 37.0 41.0 32.0 41.0 51 37.318 40.0 36.0 41.0 31.0 41.0 52 36.4525 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2304 1 0.0 2304 2 0.0 2304 3 0.0 2304 4 0.0 2304 5 0.0 2304 6 0.0 2304 7 0.0 2304 8 0.0 2304 9 0.0 2304 10 0.0 2304 11 0.0 2304 12 0.0 2304 13 0.0 2304 14 0.0 2304 15 0.0 2304 16 0.0 2304 17 0.0 2304 18 0.0 2304 19 0.0 2304 20 0.0 2304 21 0.0 2304 22 0.0 2304 23 0.0 2304 24 0.0 2304 25 0.0 2304 26 0.0 2304 27 0.0 2304 28 0.0 2304 29 0.0 2304 30 0.0 2304 31 0.0 2304 32 0.0 2304 33 0.0 2304 34 0.0 2304 35 0.0 2304 36 0.0 2304 37 0.0 2304 38 0.0 2304 39 0.0 2304 40 0.0 2304 41 0.0 2304 42 0.0 2304 43 0.0 2304 44 0.0 2304 45 0.0 2304 46 0.0 2304 47 0.0 2304 48 0.0 2304 49 0.0 2304 50 0.0 2304 51 0.0 2304 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 3.0 23 7.0 24 7.0 25 8.0 26 14.0 27 17.0 28 33.0 29 25.0 30 39.0 31 64.0 32 66.0 33 79.0 34 134.0 35 170.0 36 242.0 37 382.0 38 719.0 39 1979.0 40 10.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.110332749562176 14.435826870152615 5.203902927195396 33.249937453089814 2 22.8 16.3 34.325 26.575 3 18.775 21.45 26.55 33.225 4 24.125 28.15 23.35 24.375 5 24.55 32.300000000000004 22.650000000000002 20.5 6 20.0 33.1 23.125 23.775 7 17.05 22.1 41.4 19.45 8 17.45 21.25 30.475 30.825000000000003 9 19.625 18.95 31.75 29.675 10 19.925 34.75 23.95 21.375 11 25.775 25.124999999999996 20.225 28.875 12 23.375 21.175 25.3 30.15 13 20.925 25.6 26.950000000000003 26.525 14 20.525 24.825 27.675 26.974999999999998 15 21.725 24.375 26.450000000000003 27.450000000000003 16 22.775000000000002 24.525 26.3 26.400000000000002 17 22.875 23.799999999999997 26.724999999999998 26.6 18 21.25 25.45 26.775 26.525 19 22.8 25.275 25.874999999999996 26.05 20 22.825 26.025 24.7 26.450000000000003 21 22.3 25.474999999999998 25.55 26.674999999999997 22 22.15 24.7 27.450000000000003 25.7 23 24.075 25.275 23.35 27.3 24 20.95 24.85 26.05 28.15 25 22.575 25.1 26.05 26.275 26 22.875 24.325 25.275 27.525 27 21.775 24.474999999999998 26.025 27.725 28 22.925 25.55 25.775 25.75 29 22.5 24.425 25.525 27.55 30 21.8 24.625 26.025 27.55 31 23.0 24.6 26.0 26.400000000000002 32 22.25 24.474999999999998 26.174999999999997 27.1 33 21.725 25.874999999999996 26.325 26.075 34 22.6 24.575 26.174999999999997 26.650000000000002 35 23.0 22.75 25.874999999999996 28.375 36 23.325000000000003 25.75 24.425 26.5 37 24.375 24.925 24.625 26.075 38 22.875 25.775 24.85 26.5 39 22.675 24.525 25.3 27.500000000000004 40 23.799999999999997 25.224999999999998 25.2 25.775 41 22.475 24.7 25.95 26.875 42 22.425 24.349999999999998 25.525 27.700000000000003 43 24.349999999999998 25.324999999999996 26.1 24.224999999999998 44 22.75 24.6 24.625 28.025 45 21.975 23.925 25.45 28.65 46 23.400000000000002 24.2 26.224999999999998 26.174999999999997 47 22.85 24.2 25.174999999999997 27.775 48 22.75 24.125 26.125 27.0 49 24.0 25.174999999999997 24.55 26.275 50 23.200000000000003 23.875 25.924999999999997 27.0 51 23.125 24.15 25.2 27.525 52 24.525 23.724999999999998 24.675 27.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 2.0 21 4.0 22 3.5 23 3.0 24 6.0 25 9.0 26 11.5 27 14.0 28 18.0 29 22.0 30 27.5 31 33.0 32 34.5 33 36.0 34 54.0 35 72.0 36 86.5 37 101.0 38 117.0 39 153.0 40 173.0 41 203.0 42 233.0 43 244.5 44 256.0 45 296.5 46 337.0 47 357.0 48 377.0 49 392.0 50 407.0 51 399.0 52 391.0 53 369.0 54 347.0 55 327.5 56 308.0 57 273.5 58 239.0 59 213.5 60 188.0 61 152.0 62 116.0 63 87.0 64 56.0 65 54.0 66 37.5 67 21.0 68 19.0 69 17.0 70 14.0 71 11.0 72 13.5 73 16.0 74 14.0 75 12.0 76 7.5 77 3.0 78 3.0 79 3.0 80 1.5 81 0.0 82 1.0 83 2.0 84 1.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.44119927629879 94.25 2 2.11941070043939 4.1000000000000005 3 0.23261824760920136 0.675 4 0.15507883173946757 0.6 5 0.0 0.0 6 0.025846471956577927 0.15 7 0.0 0.0 8 0.0 0.0 9 0.025846471956577927 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 9 0.22499999999999998 No Hit GTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra Read 185558 spots for SRR5423510.sra Written 185558 spots for SRR5423510.sra Read 185539 spots for SRR5423510.sra Written 185539 spots for SRR5423510.sra SRR ids: ['SRR5423510.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7rwu25ql SRR5423510.sra spots: 3710799 blocks: [[1, 185539], [185540, 371078], [371079, 556617], [556618, 742156], [742157, 927695], [927696, 1113234], [1113235, 1298773], [1298774, 1484312], [1484313, 1669851], [1669852, 1855390], [1855391, 2040929], [2040930, 2226468], [2226469, 2412007], [2412008, 2597546], [2597547, 2783085], [2783086, 2968624], [2968625, 3154163], [3154164, 3339702], [3339703, 3525241], [3525242, 3710799]] SRR5423510 file size 652982 SRR5423510 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423510 SRR5423510_1.fastq Input file: SRR5423510_1.fastq trimmed: SRR5423510-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 16:37:52 2025 >> started Wed Feb 12 16:37:54 2025 >> done (1.874s) 3710799 reads processed; of these: 238 ( 0.01%) short reads filtered out after trimming by size control 167 ( 0.00%) empty reads filtered out after trimming by size control 3710394 (99.99%) reads available; of these: 56563 ( 1.52%) trimmed reads available after processing 3653831 (98.48%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 6 0.00% 20 8 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 3 0.00% 26 2 0.00% 27 3 0.00% 28 1 0.00% 29 6 0.00% 30 3 0.00% 31 14 0.00% 32 12 0.00% 33 14 0.00% 34 13 0.00% 35 22 0.00% 36 25 0.00% 37 39 0.00% 38 30 0.00% 39 41 0.00% 40 63 0.00% 41 94 0.00% 42 88 0.00% 43 125 0.00% 44 185 0.00% 45 314 0.01% 46 493 0.01% 47 622 0.02% 48 1083 0.03% 49 2206 0.06% 50 6370 0.17% 51 44665 1.20% 52 3653831 98.48% 3710394 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.24 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=25.57 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.5 sequence=TTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGATCGAAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGACCCGGCCAGTTAAGGCCAGGAGCGCATCGCCG Started job on | Feb 12 16:38:07 Started mapping on | Feb 12 16:38:07 Finished on | Feb 12 16:38:12 Mapping speed, Million of reads per hour | 2671.48 Number of input reads | 3710394 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3157896 Uniquely mapped reads % | 85.11% Average mapped length | 51.84 Number of splices: Total | 389185 Number of splices: Annotated (sjdb) | 385108 Number of splices: GT/AG | 382048 Number of splices: GC/AG | 6552 Number of splices: AT/AC | 205 Number of splices: Non-canonical | 380 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.01% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 277526 % of reads mapped to multiple loci | 7.48% Number of reads mapped to too many loci | 261975 % of reads mapped to too many loci | 7.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.35% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 274972 274972 274972 N_multimapping 277526 277526 277526 N_noFeature 209134 3118980 223414 N_ambiguous 40295 29 15645 UnstrandedReadsAssigned:2908467 PositiveStrandReadsAssigned:38887 NegativeStrandReadsAssigned:2918837 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423510 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423510-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,710,394 reads, 3,212,183 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR5423510.ke.tsv 34699 SRR5423510.se.tsv 87100 total ==> SRR5423510.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 41 7.1308 Potri.005G024800.1.v4.1 1035 936 2.00229 0.713969 Potri.004G059700.1.v4.1 961 862 11 4.25907 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 27.3932 3.21472 Potri.016G087400.1.v4.1 270 171 79 154.191 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 57 21.6675 ==> SRR5423510.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 53 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR5423510 completed mapping pipeline successfully