Starting /dee2/code/volunteer_pipeline.sh SRR5423511 current disk space = 3051950419968 free memory = 1443240284 SRR5423511 SRAfilesize f7c023fc431533165061fbfc064b326a SRR5423511.sra SRR5423511.sra file validated SRR5423511 is single end SRR5423511 is conventional basespace SRR5423511 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423511_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.407 34.0 31.0 34.0 27.0 34.0 2 31.6635 34.0 31.0 34.0 27.0 34.0 3 32.5565 34.0 31.0 34.0 28.0 34.0 4 36.133 37.0 35.0 37.0 35.0 37.0 5 36.1715 37.0 37.0 37.0 35.0 37.0 6 36.26225 37.0 37.0 37.0 35.0 37.0 7 36.274 37.0 37.0 37.0 35.0 37.0 8 36.30925 37.0 37.0 37.0 35.0 37.0 9 38.14475 39.0 39.0 39.0 37.0 39.0 10 38.094 39.0 38.0 39.0 35.0 39.0 11 37.8755 39.0 38.0 39.0 35.0 39.0 12 38.06425 39.0 38.0 39.0 35.0 39.0 13 38.01525 39.0 38.0 39.0 35.0 39.0 14 39.55775 41.0 40.0 41.0 37.0 41.0 15 39.51475 41.0 40.0 41.0 37.0 41.0 16 39.48025 41.0 39.0 41.0 36.0 41.0 17 39.47675 41.0 39.0 41.0 37.0 41.0 18 39.50225 41.0 39.0 41.0 37.0 41.0 19 39.50775 41.0 39.0 41.0 37.0 41.0 20 39.50525 41.0 39.0 41.0 37.0 41.0 21 39.3945 41.0 39.0 41.0 37.0 41.0 22 39.376 41.0 39.0 41.0 36.0 41.0 23 39.3155 41.0 39.0 41.0 36.0 41.0 24 39.3045 41.0 39.0 41.0 36.0 41.0 25 39.32475 41.0 39.0 41.0 36.0 41.0 26 39.286 41.0 39.0 41.0 36.0 41.0 27 39.2245 40.0 39.0 41.0 36.0 41.0 28 39.23825 41.0 39.0 41.0 36.0 41.0 29 39.28075 41.0 39.0 41.0 36.0 41.0 30 39.1995 41.0 39.0 41.0 36.0 41.0 31 39.23675 40.0 39.0 41.0 36.0 41.0 32 39.1735 40.0 39.0 41.0 36.0 41.0 33 39.09225 40.0 39.0 41.0 36.0 41.0 34 39.1205 40.0 39.0 41.0 36.0 41.0 35 39.01675 40.0 39.0 41.0 35.0 41.0 36 38.978 40.0 39.0 41.0 35.0 41.0 37 38.945 40.0 39.0 41.0 35.0 41.0 38 38.82525 40.0 38.0 41.0 35.0 41.0 39 38.70975 40.0 38.0 41.0 35.0 41.0 40 38.63175 40.0 38.0 41.0 35.0 41.0 41 38.5235 40.0 38.0 41.0 34.0 41.0 42 38.40125 40.0 38.0 41.0 34.0 41.0 43 38.457 40.0 38.0 41.0 34.0 41.0 44 38.28875 40.0 38.0 41.0 33.0 41.0 45 38.24775 40.0 38.0 41.0 34.0 41.0 46 38.3635 40.0 38.0 41.0 34.0 41.0 47 38.285 40.0 38.0 41.0 34.0 41.0 48 38.06575 40.0 38.0 41.0 33.0 41.0 49 37.98475 40.0 38.0 41.0 33.0 41.0 50 37.93575 40.0 37.0 41.0 33.0 41.0 51 37.929 40.0 37.0 41.0 33.0 41.0 52 36.09275 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 4.0 23 0.0 24 1.0 25 6.0 26 9.0 27 11.0 28 16.0 29 20.0 30 39.0 31 51.0 32 57.0 33 65.0 34 110.0 35 161.0 36 227.0 37 346.0 38 789.0 39 2079.0 40 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.8833922261484 13.454743136721936 5.3818972546887744 30.27996738244088 2 22.45 15.85 34.9 26.8 3 20.1 21.8 27.425 30.675 4 24.075 28.999999999999996 23.125 23.799999999999997 5 24.175 32.800000000000004 22.575 20.45 6 19.575 33.324999999999996 22.7 24.4 7 16.225 21.825 41.325 20.625 8 17.775 18.85 31.8 31.574999999999996 9 17.974999999999998 20.225 31.8 30.0 10 20.5 35.099999999999994 23.674999999999997 20.724999999999998 11 23.599999999999998 25.575 20.775 30.049999999999997 12 22.825 21.525 25.674999999999997 29.975 13 20.349999999999998 25.6 28.199999999999996 25.85 14 20.625 25.0 28.000000000000004 26.375 15 21.85 24.425 27.450000000000003 26.275 16 23.075000000000003 25.324999999999996 25.55 26.05 17 22.55 23.599999999999998 26.724999999999998 27.125 18 22.0 25.6 25.724999999999998 26.674999999999997 19 22.5 27.05 26.3 24.15 20 24.275 24.975 26.0 24.75 21 21.8 25.025 25.974999999999998 27.200000000000003 22 22.575 26.424999999999997 26.174999999999997 24.825 23 22.2 25.124999999999996 25.624999999999996 27.05 24 21.5 25.6 25.424999999999997 27.474999999999998 25 23.525 25.95 25.650000000000002 24.875 26 24.2 23.75 25.374999999999996 26.674999999999997 27 21.025 25.8 25.7 27.474999999999998 28 22.475 26.3 25.75 25.474999999999998 29 22.375 24.7 25.95 26.974999999999998 30 21.625 24.6 27.0 26.775 31 22.475 26.25 24.875 26.400000000000002 32 21.85 26.075 25.525 26.55 33 22.325 25.674999999999997 25.55 26.450000000000003 34 22.475 25.275 25.85 26.400000000000002 35 23.35 23.625 25.900000000000002 27.125 36 21.575 23.925 26.875 27.625 37 23.724999999999998 24.3 25.2 26.775 38 22.675 24.65 27.05 25.624999999999996 39 22.85 23.7 25.85 27.6 40 24.05 24.725 24.625 26.6 41 22.925 23.275000000000002 25.6 28.199999999999996 42 21.925 25.3 25.45 27.325 43 22.175 24.275 26.974999999999998 26.575 44 22.875 24.2 26.724999999999998 26.200000000000003 45 22.900000000000002 24.275 26.400000000000002 26.424999999999997 46 23.25 24.525 26.400000000000002 25.825 47 23.45 24.15 25.874999999999996 26.525 48 22.725 24.099999999999998 24.7 28.475 49 23.25 23.150000000000002 27.200000000000003 26.400000000000002 50 24.25 23.974999999999998 24.925 26.85 51 22.475 23.625 26.575 27.325 52 24.3 24.525 24.975 26.200000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 1.5 15 3.0 16 2.0 17 1.0 18 2.0 19 3.0 20 2.5 21 2.0 22 1.5 23 1.0 24 4.0 25 7.0 26 8.5 27 10.0 28 18.5 29 27.0 30 34.0 31 41.0 32 47.5 33 54.0 34 54.0 35 54.0 36 77.5 37 101.0 38 111.5 39 153.5 40 185.0 41 215.0 42 245.0 43 264.5 44 284.0 45 329.0 46 374.0 47 370.5 48 367.0 49 389.5 50 412.0 51 393.5 52 375.0 53 376.0 54 377.0 55 353.0 56 329.0 57 272.5 58 216.0 59 186.5 60 157.0 61 126.0 62 95.0 63 75.5 64 49.0 65 42.0 66 31.0 67 20.0 68 19.0 69 18.0 70 12.5 71 7.0 72 6.5 73 6.0 74 4.5 75 3.0 76 2.5 77 2.0 78 1.5 79 1.0 80 1.5 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.12387561038294 95.45 2 1.3878180416345411 2.7 3 0.2570033410434336 0.75 4 0.10280133641737343 0.4 5 0.05140066820868672 0.25 6 0.07710100231303006 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 6 0.15 No Hit GTCGAATCCGATTATACGGATAAAGGCGTTAGGGTAAGCTTTCTTTGCCTCC 6 0.15 No Hit GCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAAT 6 0.15 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 5 0.125 No Hit GTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra Read 200000 spots for SRR5423511.sra Written 200000 spots for SRR5423511.sra SRR ids: ['SRR5423511.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uiwu9vq1 SRR5423511.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423511 file size 704013 SRR5423511 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423511 SRR5423511_1.fastq Input file: SRR5423511_1.fastq trimmed: SRR5423511-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 16:15:05 2025 >> started Wed Feb 12 16:15:08 2025 >> done (2.897s) 4000000 reads processed; of these: 224 ( 0.01%) short reads filtered out after trimming by size control 302 ( 0.01%) empty reads filtered out after trimming by size control 3999474 (99.99%) reads available; of these: 55831 ( 1.40%) trimmed reads available after processing 3943643 (98.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 10 0.00% 20 11 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 3 0.00% 25 4 0.00% 26 4 0.00% 27 1 0.00% 28 3 0.00% 29 4 0.00% 30 9 0.00% 31 2 0.00% 32 12 0.00% 33 16 0.00% 34 12 0.00% 35 10 0.00% 36 15 0.00% 37 35 0.00% 38 46 0.00% 39 42 0.00% 40 48 0.00% 41 84 0.00% 42 75 0.00% 43 118 0.00% 44 150 0.00% 45 262 0.01% 46 371 0.01% 47 539 0.01% 48 851 0.02% 49 1945 0.05% 50 5912 0.15% 51 45221 1.13% 52 3943643 98.60% 3999474 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=35 prefix-density=0.22 prefix-fanout=2.0 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=11.63 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=3.4 sequence=GAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCCGTAGGCTTGTCACTGGCACCCGGCGAGTAAACGATGTGCTGACCATGGCGCTGGAGAGGGC Started job on | Feb 12 16:15:21 Started mapping on | Feb 12 16:15:22 Finished on | Feb 12 16:15:27 Mapping speed, Million of reads per hour | 2879.62 Number of input reads | 3999474 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3649099 Uniquely mapped reads % | 91.24% Average mapped length | 51.84 Number of splices: Total | 476093 Number of splices: Annotated (sjdb) | 470869 Number of splices: GT/AG | 467623 Number of splices: GC/AG | 7740 Number of splices: AT/AC | 268 Number of splices: Non-canonical | 462 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 270520 % of reads mapped to multiple loci | 6.76% Number of reads mapped to too many loci | 67076 % of reads mapped to too many loci | 1.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.32% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 79855 79855 79855 N_multimapping 270520 270520 270520 N_noFeature 124612 3608177 141475 N_ambiguous 44560 34 20483 UnstrandedReadsAssigned:3479927 PositiveStrandReadsAssigned:40888 NegativeStrandReadsAssigned:3487141 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423511 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423511-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,474 reads, 3,668,494 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,132 rounds 52401 SRR5423511.ke.tsv 34699 SRR5423511.se.tsv 87100 total ==> SRR5423511.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 79 11.4809 Potri.005G024800.1.v4.1 1035 936 6 1.78771 Potri.004G059700.1.v4.1 961 862 7 2.26471 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 27.2889 2.67596 Potri.016G087400.1.v4.1 270 171 91 148.412 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.166597 Potri.012G127500.1.v4.1 977 878 108 34.3045 ==> SRR5423511.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 67 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR5423511 completed mapping pipeline successfully