Starting /dee2/code/volunteer_pipeline.sh SRR5423512 current disk space = 3092868349952 free memory = 1383429920 SRR5423512 SRAfilesize 08c75e631505760e3a594b90ac4acb32 SRR5423512.sra SRR5423512.sra file validated SRR5423512 is single end SRR5423512 is conventional basespace SRR5423512 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423512_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.117 31.0 31.0 34.0 26.0 34.0 2 31.1865 31.0 31.0 34.0 28.0 34.0 3 31.80025 33.0 31.0 34.0 28.0 34.0 4 32.73075 35.0 33.0 37.0 22.0 37.0 5 34.667 35.0 35.0 37.0 32.0 37.0 6 35.128 37.0 35.0 37.0 32.0 37.0 7 35.50375 37.0 35.0 37.0 33.0 37.0 8 35.4885 37.0 35.0 37.0 33.0 37.0 9 37.224 39.0 37.0 39.0 33.0 39.0 10 37.2525 39.0 37.0 39.0 33.0 39.0 11 37.27725 39.0 37.0 39.0 34.0 39.0 12 37.20425 39.0 37.0 39.0 33.0 39.0 13 37.26375 39.0 37.0 39.0 34.0 39.0 14 38.413 40.0 38.0 41.0 33.0 41.0 15 38.75025 40.0 38.0 41.0 34.0 41.0 16 38.48425 40.0 38.0 41.0 34.0 41.0 17 38.3805 40.0 38.0 41.0 33.0 41.0 18 38.37875 40.0 38.0 41.0 33.0 41.0 19 38.437 40.0 38.0 41.0 34.0 41.0 20 38.32 40.0 38.0 41.0 33.0 41.0 21 38.43275 40.0 38.0 41.0 34.0 41.0 22 38.31525 40.0 38.0 41.0 34.0 41.0 23 38.3195 40.0 38.0 41.0 34.0 41.0 24 38.56125 40.0 38.0 41.0 34.0 41.0 25 38.4635 40.0 38.0 41.0 34.0 41.0 26 38.31425 40.0 38.0 41.0 34.0 41.0 27 38.281 40.0 38.0 41.0 34.0 41.0 28 38.39625 40.0 38.0 41.0 34.0 41.0 29 38.24175 40.0 38.0 41.0 34.0 41.0 30 37.9345 40.0 38.0 41.0 33.0 41.0 31 37.99875 40.0 38.0 41.0 33.0 41.0 32 37.75025 40.0 38.0 41.0 33.0 41.0 33 37.722 40.0 38.0 41.0 33.0 41.0 34 37.68225 40.0 38.0 41.0 33.0 41.0 35 37.818 40.0 37.0 41.0 33.0 41.0 36 37.66 40.0 37.0 41.0 32.0 41.0 37 37.65375 40.0 37.0 41.0 32.0 41.0 38 37.806 40.0 37.0 41.0 33.0 41.0 39 37.8465 40.0 37.0 41.0 33.0 41.0 40 37.74425 40.0 37.0 41.0 32.0 41.0 41 37.7035 40.0 37.0 41.0 33.0 41.0 42 37.7845 40.0 37.0 41.0 33.0 41.0 43 37.68125 40.0 37.0 41.0 33.0 41.0 44 37.6995 40.0 37.0 41.0 32.0 41.0 45 37.73175 40.0 37.0 41.0 32.0 41.0 46 37.591 40.0 37.0 41.0 32.0 41.0 47 37.2885 39.0 36.0 41.0 31.0 41.0 48 37.4215 39.0 36.0 41.0 31.0 41.0 49 37.16425 39.0 36.0 41.0 31.0 41.0 50 37.4535 39.0 36.0 41.0 31.0 41.0 51 37.348 39.0 36.0 41.0 32.0 41.0 52 36.5435 38.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality fail #Tile Base Mean 1113 1 13.998052519160698 1113 2 7.379570297776102 1113 3 2.0356828747330056 1113 4 -1.1208066339992442 1113 5 -0.3895589898228451 1113 6 -0.4497424299535169 1113 7 -0.2163588390501303 1113 8 -0.26510868199522264 1113 9 -0.7791808016082413 1113 10 -0.291179796456845 1113 11 -0.5119361728860454 1113 12 -0.538635506973236 1113 13 -0.5662143485362492 1113 14 -0.25172760397034466 1113 15 -0.08807639150646907 1113 16 -0.5192235205427806 1113 17 -0.4727352682497781 1113 18 -0.3905013192612117 1113 19 -0.5400804121120686 1113 20 -0.3456464379947235 1113 21 -0.5416509611760247 1113 22 -0.6855132554340955 1113 23 -0.6778489760020108 1113 24 -0.38447041085563427 1113 25 -0.5657117728357832 1113 26 -0.47034803367257183 1113 27 -0.5735016961929915 1113 28 -0.6844452820706124 1113 29 -0.7860912174896342 1113 30 -1.1214348536248266 1113 31 -1.0475562256564928 1113 32 -0.9531976378942062 1113 33 -1.1356326171629618 1113 34 -1.073376052267875 1113 35 -0.7167357708254798 1113 36 -0.7161703731624556 1113 37 -0.1268375424048287 1113 38 -0.4591029023746742 1113 39 -0.20768940821711368 1113 40 -0.8236587510993871 1113 41 -0.7864053273024254 1113 42 -0.3131046613896231 1113 43 -0.5329815303430081 1113 44 -0.7616534740545262 1113 45 -0.4941575574820902 1113 46 -0.5498806382711408 1113 47 -0.2702600829249917 1113 48 -0.2823218997361465 1113 49 -0.41041588139213303 1113 50 -0.643422540520163 1113 51 -0.037818821459978835 1113 52 -0.3528709636889005 1114 1 -13.9980525191607 1114 2 -7.379570297776102 1114 3 -2.035682874733009 1114 4 1.1208066339992442 1114 5 0.389558989822838 1114 6 0.44974242995350977 1114 7 0.2163588390501303 1114 8 0.26510868199522264 1114 9 0.7791808016082413 1114 10 0.2911797964568379 1114 11 0.5119361728860383 1114 12 0.538635506973236 1114 13 0.5662143485362492 1114 14 0.25172760397035177 1114 15 0.08807639150646907 1114 16 0.5192235205427806 1114 17 0.4727352682497852 1114 18 0.3905013192612188 1114 19 0.5400804121120757 1114 20 0.3456464379947235 1114 21 0.5416509611760247 1114 22 0.6855132554341026 1114 23 0.6778489760020108 1114 24 0.3844704108556414 1114 25 0.5657117728357832 1114 26 0.47034803367257183 1114 27 0.5735016961929844 1114 28 0.6844452820706124 1114 29 0.7860912174896342 1114 30 1.1214348536248337 1114 31 1.0475562256564928 1114 32 0.9531976378942133 1114 33 1.1356326171629618 1114 34 1.073376052267875 1114 35 0.7167357708254798 1114 36 0.7161703731624556 1114 37 0.1268375424048216 1114 38 0.4591029023746671 1114 39 0.20768940821711368 1114 40 0.8236587510993871 1114 41 0.7864053273024254 1114 42 0.3131046613896231 1114 43 0.5329815303430081 1114 44 0.7616534740545333 1114 45 0.49415755748209733 1114 46 0.5498806382711408 1114 47 0.2702600829249846 1114 48 0.2823218997361465 1114 49 0.41041588139213303 1114 50 0.6434225405201701 1114 51 0.03781882145998594 1114 52 0.3528709636889076 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 2.0 23 3.0 24 2.0 25 7.0 26 12.0 27 15.0 28 31.0 29 46.0 30 72.0 31 76.0 32 113.0 33 176.0 34 197.0 35 257.0 36 360.0 37 521.0 38 808.0 39 1297.0 40 3.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 49.12096562582 14.851744948832327 5.247966413014956 30.77932301233272 2 22.025 15.9 35.35 26.724999999999998 3 19.075 21.95 27.35 31.624999999999996 4 24.925 29.299999999999997 23.275000000000002 22.5 5 23.474999999999998 34.1 22.475 19.950000000000003 6 20.65 32.25 23.775 23.325000000000003 7 17.325 21.7 40.45 20.525 8 18.9 20.8 29.549999999999997 30.75 9 18.425 20.974999999999998 32.125 28.475 10 19.5 37.2 23.175 20.125 11 25.3 26.525 20.200000000000003 27.975 12 23.025000000000002 22.475 24.15 30.349999999999998 13 21.325 26.150000000000002 28.499999999999996 24.025 14 20.674999999999997 24.5 27.875 26.950000000000003 15 21.95 24.2 26.575 27.275 16 22.3 26.0 26.325 25.374999999999996 17 22.8 25.874999999999996 26.224999999999998 25.1 18 21.525 23.9 26.474999999999998 28.1 19 22.925 25.974999999999998 26.450000000000003 24.65 20 22.7 25.324999999999996 26.400000000000002 25.575 21 22.85 24.575 26.25 26.325 22 23.45 25.4 25.775 25.374999999999996 23 22.900000000000002 26.6 25.3 25.2 24 22.975 23.724999999999998 26.125 27.175 25 22.15 25.6 26.0 26.25 26 23.3 25.05 25.124999999999996 26.525 27 21.15 25.724999999999998 26.35 26.775 28 21.7 26.025 26.625 25.650000000000002 29 22.746673361787597 25.709264373587747 25.106703489831784 26.43735877479287 30 22.410308236483072 25.063163213744318 25.972713491662457 26.553815058110157 31 22.90826612903226 24.672379032258064 25.932459677419356 26.486895161290324 32 21.656534954407295 25.53191489361702 27.178318135764947 25.633232016210737 33 21.666243332486665 25.06985013970028 26.49225298450597 26.77165354330709 34 22.813688212927758 24.689480354879596 25.475285171102662 27.021546261089984 35 22.82251956576622 25.145165362282253 25.296642262055038 26.735672809896492 36 21.711847389558233 25.35140562248996 25.803212851405622 27.133534136546185 37 23.825 25.424999999999997 25.5 25.25 38 23.275000000000002 24.6 25.674999999999997 26.450000000000003 39 23.825 24.575 25.275 26.325 40 22.25 26.1 25.074999999999996 26.575 41 23.125 25.1 26.150000000000002 25.624999999999996 42 22.35 24.425 25.4 27.825 43 22.650000000000002 24.925 26.5 25.924999999999997 44 22.0 24.675 26.6 26.724999999999998 45 23.65 23.225 26.05 27.075 46 23.775 25.224999999999998 25.424999999999997 25.575 47 23.5 25.674999999999997 25.8 25.025 48 22.05 24.425 25.45 28.075 49 22.400000000000002 25.6 25.724999999999998 26.275 50 22.15 25.05 25.8 27.0 51 22.325 24.275 26.674999999999997 26.724999999999998 52 23.125 24.9 26.05 25.924999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 2.0 22 3.5 23 5.0 24 7.5 25 10.0 26 13.5 27 17.0 28 23.5 29 30.0 30 30.0 31 30.0 32 44.5 33 59.0 34 70.5 35 82.0 36 94.0 37 106.0 38 117.5 39 164.0 40 199.0 41 216.5 42 234.0 43 280.5 44 327.0 45 318.5 46 310.0 47 346.5 48 383.0 49 398.0 50 413.0 51 392.5 52 372.0 53 382.0 54 392.0 55 351.0 56 310.0 57 256.5 58 203.0 59 180.5 60 158.0 61 125.5 62 93.0 63 67.0 64 41.5 65 42.0 66 33.0 67 24.0 68 17.5 69 11.0 70 6.0 71 1.0 72 4.5 73 8.0 74 6.0 75 4.0 76 2.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.42500000000000004 30 1.05 31 0.8 32 1.3 33 1.575 34 1.375 35 0.975 36 0.4 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.12676417757248 95.6 2 1.3600205286117526 2.65 3 0.2822684115986656 0.8250000000000001 4 0.2052861175263023 0.8 5 0.025660764690787787 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra Read 200000 spots for SRR5423512.sra Written 200000 spots for SRR5423512.sra SRR ids: ['SRR5423512.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xrcxkjl_ SRR5423512.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423512 file size 703976 SRR5423512 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423512 SRR5423512_1.fastq Input file: SRR5423512_1.fastq trimmed: SRR5423512-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 11:58:43 2025 >> started Thu Feb 13 11:58:45 2025 >> done (2.016s) 4000000 reads processed; of these: 218 ( 0.01%) short reads filtered out after trimming by size control 320 ( 0.01%) empty reads filtered out after trimming by size control 3999462 (99.99%) reads available; of these: 67077 ( 1.68%) trimmed reads available after processing 3932385 (98.32%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 8 0.00% 20 7 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 3 0.00% 25 1 0.00% 26 4 0.00% 27 5 0.00% 28 4 0.00% 29 7 0.00% 30 10 0.00% 31 8 0.00% 32 20 0.00% 33 17 0.00% 34 14 0.00% 35 18 0.00% 36 17 0.00% 37 39 0.00% 38 33 0.00% 39 40 0.00% 40 62 0.00% 41 95 0.00% 42 96 0.00% 43 150 0.00% 44 202 0.01% 45 294 0.01% 46 425 0.01% 47 640 0.02% 48 1140 0.03% 49 2408 0.06% 50 7375 0.18% 51 53921 1.35% 52 3932385 98.32% 3999462 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=33 prefix-density=0.21 prefix-fanout=2.0 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=12.45 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=3.5 sequence=GAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCCGTAGGCTTGTCACTGGCACCCGGCGAGTAAACGATGTGCTGACCATGGCGCTGGAGAGGGC Started job on | Feb 13 11:59:00 Started mapping on | Feb 13 11:59:00 Finished on | Feb 13 11:59:05 Mapping speed, Million of reads per hour | 2879.61 Number of input reads | 3999462 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3649343 Uniquely mapped reads % | 91.25% Average mapped length | 51.84 Number of splices: Total | 475645 Number of splices: Annotated (sjdb) | 470448 Number of splices: GT/AG | 467247 Number of splices: GC/AG | 7689 Number of splices: AT/AC | 264 Number of splices: Non-canonical | 445 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 270429 % of reads mapped to multiple loci | 6.76% Number of reads mapped to too many loci | 66593 % of reads mapped to too many loci | 1.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.32% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 79690 79690 79690 N_multimapping 270429 270429 270429 N_noFeature 125782 3608239 142838 N_ambiguous 44881 36 20814 UnstrandedReadsAssigned:3478680 PositiveStrandReadsAssigned:41068 NegativeStrandReadsAssigned:3485691 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423512 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423512-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,462 reads, 3,664,635 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR5423512.ke.tsv 34699 SRR5423512.se.tsv 87100 total ==> SRR5423512.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 64 9.32587 Potri.005G024800.1.v4.1 1035 936 9 2.68875 Potri.004G059700.1.v4.1 961 862 6 1.94638 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 39 3.83459 Potri.016G087400.1.v4.1 270 171 98 160.256 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.167043 Potri.012G127500.1.v4.1 977 878 115 36.6259 ==> SRR5423512.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 65 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR5423512 completed mapping pipeline successfully