Starting /dee2/code/volunteer_pipeline.sh SRR5423513 current disk space = 3092191305728 free memory = 1409380052 SRR5423513 SRAfilesize 735db47f0dc1d76c47d6a92f78787488 SRR5423513.sra SRR5423513.sra file validated SRR5423513 is single end SRR5423513 is conventional basespace SRR5423513 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423513_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.27725 34.0 31.0 34.0 30.0 34.0 2 32.3215 34.0 31.0 34.0 30.0 34.0 3 32.4055 34.0 31.0 34.0 30.0 34.0 4 35.8605 37.0 35.0 37.0 35.0 37.0 5 35.80825 37.0 35.0 37.0 35.0 37.0 6 35.83825 37.0 35.0 37.0 35.0 37.0 7 35.714 37.0 35.0 37.0 33.0 37.0 8 35.82175 37.0 35.0 37.0 33.0 37.0 9 37.37725 39.0 37.0 39.0 34.0 39.0 10 37.34825 39.0 37.0 39.0 34.0 39.0 11 37.54875 39.0 37.0 39.0 35.0 39.0 12 37.584 39.0 37.0 39.0 35.0 39.0 13 37.52325 39.0 37.0 39.0 35.0 39.0 14 38.95425 40.0 38.0 41.0 36.0 41.0 15 38.9175 40.0 38.0 41.0 35.0 41.0 16 38.827 40.0 38.0 41.0 35.0 41.0 17 38.76975 40.0 38.0 41.0 35.0 41.0 18 38.7845 40.0 38.0 41.0 35.0 41.0 19 38.81475 40.0 38.0 41.0 34.0 41.0 20 38.58925 40.0 38.0 41.0 34.0 41.0 21 38.74175 40.0 38.0 41.0 34.0 41.0 22 38.81575 40.0 38.0 41.0 35.0 41.0 23 38.7415 40.0 38.0 41.0 34.0 41.0 24 38.58375 40.0 38.0 41.0 34.0 41.0 25 38.7265 40.0 38.0 41.0 34.0 41.0 26 38.613 40.0 38.0 41.0 34.0 41.0 27 38.49375 40.0 38.0 41.0 34.0 41.0 28 38.62975 40.0 38.0 41.0 34.0 41.0 29 38.481 40.0 38.0 41.0 34.0 41.0 30 38.64325 40.0 38.0 41.0 35.0 41.0 31 38.5325 40.0 38.0 41.0 34.0 41.0 32 38.539 40.0 38.0 41.0 34.0 41.0 33 38.58625 40.0 38.0 41.0 34.0 41.0 34 38.6 40.0 38.0 41.0 34.0 41.0 35 38.54525 40.0 38.0 41.0 34.0 41.0 36 38.3895 40.0 38.0 41.0 34.0 41.0 37 38.2705 40.0 38.0 41.0 33.0 41.0 38 38.19525 40.0 38.0 41.0 33.0 41.0 39 38.14075 40.0 38.0 41.0 33.0 41.0 40 38.24325 40.0 38.0 41.0 33.0 41.0 41 38.2525 40.0 38.0 41.0 33.0 41.0 42 38.10925 40.0 38.0 41.0 33.0 41.0 43 38.03425 40.0 38.0 41.0 33.0 41.0 44 37.983 40.0 37.0 41.0 33.0 41.0 45 37.79525 40.0 37.0 41.0 32.0 41.0 46 37.8215 40.0 37.0 41.0 33.0 41.0 47 37.71 40.0 37.0 41.0 32.0 41.0 48 37.7655 40.0 37.0 41.0 32.0 41.0 49 37.707 40.0 37.0 41.0 32.0 41.0 50 37.73425 40.0 37.0 41.0 32.0 41.0 51 37.64975 40.0 37.0 41.0 32.0 41.0 52 36.5185 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1210 1 0.0 1210 2 0.0 1210 3 0.0 1210 4 0.0 1210 5 0.0 1210 6 0.0 1210 7 0.0 1210 8 0.0 1210 9 0.0 1210 10 0.0 1210 11 0.0 1210 12 0.0 1210 13 0.0 1210 14 0.0 1210 15 0.0 1210 16 0.0 1210 17 0.0 1210 18 0.0 1210 19 0.0 1210 20 0.0 1210 21 0.0 1210 22 0.0 1210 23 0.0 1210 24 0.0 1210 25 0.0 1210 26 0.0 1210 27 0.0 1210 28 0.0 1210 29 0.0 1210 30 0.0 1210 31 0.0 1210 32 0.0 1210 33 0.0 1210 34 0.0 1210 35 0.0 1210 36 0.0 1210 37 0.0 1210 38 0.0 1210 39 0.0 1210 40 0.0 1210 41 0.0 1210 42 0.0 1210 43 0.0 1210 44 0.0 1210 45 0.0 1210 46 0.0 1210 47 0.0 1210 48 0.0 1210 49 0.0 1210 50 0.0 1210 51 0.0 1210 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 0.0 22 0.0 23 2.0 24 6.0 25 4.0 26 10.0 27 18.0 28 30.0 29 30.0 30 51.0 31 71.0 32 92.0 33 129.0 34 144.0 35 193.0 36 270.0 37 400.0 38 688.0 39 1848.0 40 10.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 49.27318295739349 13.43358395989975 5.338345864661654 31.954887218045116 2 22.025 15.825 35.725 26.424999999999997 3 17.724999999999998 21.0 29.099999999999998 32.175 4 24.625 29.225 22.625 23.525 5 23.1 31.924999999999997 23.525 21.45 6 20.5 32.425 23.9 23.175 7 17.5 22.075 40.050000000000004 20.375 8 18.575 21.9 29.2 30.325000000000003 9 18.975 19.1 33.575 28.349999999999998 10 20.200000000000003 35.85 22.95 21.0 11 25.474999999999998 24.25 20.775 29.5 12 23.075000000000003 21.525 24.7 30.7 13 20.45 25.525 28.675 25.35 14 21.5 25.25 27.825 25.424999999999997 15 21.85 24.825 26.025 27.3 16 23.075000000000003 25.45 25.525 25.95 17 22.7 25.624999999999996 25.724999999999998 25.95 18 21.65 25.224999999999998 25.374999999999996 27.750000000000004 19 23.3 25.7 25.2 25.8 20 23.0 25.45 25.424999999999997 26.125 21 22.55 25.7 25.275 26.474999999999998 22 22.625 27.075 25.6 24.7 23 22.825 24.349999999999998 26.8 26.025 24 20.575 25.75 25.650000000000002 28.025 25 21.95 25.324999999999996 25.224999999999998 27.500000000000004 26 22.85 25.55 26.85 24.75 27 21.875 24.474999999999998 26.525 27.125 28 23.875 24.625 26.35 25.15 29 24.025 23.724999999999998 25.0 27.250000000000004 30 22.2 23.724999999999998 26.575 27.500000000000004 31 22.275 25.674999999999997 25.424999999999997 26.625 32 22.650000000000002 25.025 25.525 26.8 33 22.95 24.474999999999998 25.5 27.075 34 22.525000000000002 26.150000000000002 25.624999999999996 25.7 35 24.075 24.224999999999998 26.35 25.35 36 23.1 25.35 25.124999999999996 26.424999999999997 37 23.9 25.275 24.875 25.95 38 23.125 25.074999999999996 25.45 26.35 39 21.975 24.474999999999998 26.125 27.425 40 22.650000000000002 26.474999999999998 24.625 26.25 41 23.1 25.474999999999998 26.224999999999998 25.2 42 22.95 24.8 25.775 26.474999999999998 43 23.375 24.45 25.124999999999996 27.05 44 21.4 25.324999999999996 26.575 26.700000000000003 45 22.475 25.525 25.724999999999998 26.275 46 23.575 23.95 26.05 26.424999999999997 47 22.45 25.575 25.95 26.025 48 21.25 25.025 25.85 27.875 49 22.875 25.3 25.374999999999996 26.450000000000003 50 24.0 23.549999999999997 25.45 27.0 51 22.35 23.625 26.6 27.425 52 24.175 24.525 24.425 26.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 3.0 18 2.5 19 2.0 20 2.0 21 2.0 22 2.0 23 2.0 24 4.5 25 7.0 26 9.5 27 12.0 28 13.0 29 14.0 30 31.0 31 48.0 32 50.0 33 52.0 34 55.5 35 59.0 36 78.0 37 97.0 38 112.5 39 166.0 40 204.0 41 215.5 42 227.0 43 249.0 44 271.0 45 305.5 46 340.0 47 344.5 48 349.0 49 370.0 50 391.0 51 411.5 52 432.0 53 418.5 54 405.0 55 370.5 56 336.0 57 266.5 58 197.0 59 177.5 60 158.0 61 137.0 62 116.0 63 86.5 64 51.5 65 46.0 66 31.5 67 17.0 68 15.5 69 14.0 70 9.5 71 5.0 72 5.5 73 6.0 74 3.5 75 1.0 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.2 #Duplication Level Percentage of deduplicated Percentage of total 1 97.81378600823045 95.075 2 1.8261316872427984 3.55 3 0.257201646090535 0.75 4 0.0257201646090535 0.1 5 0.0 0.0 6 0.0257201646090535 0.15 7 0.0257201646090535 0.17500000000000002 8 0.0257201646090535 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 8 0.2 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 7 0.17500000000000002 No Hit GTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAAT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra Read 200000 spots for SRR5423513.sra Written 200000 spots for SRR5423513.sra SRR ids: ['SRR5423513.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g95atpkt SRR5423513.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423513 file size 703979 SRR5423513 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423513 SRR5423513_1.fastq Input file: SRR5423513_1.fastq trimmed: SRR5423513-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:25:47 2025 >> started Thu Feb 13 12:25:49 2025 >> done (1.881s) 4000000 reads processed; of these: 207 ( 0.01%) short reads filtered out after trimming by size control 330 ( 0.01%) empty reads filtered out after trimming by size control 3999463 (99.99%) reads available; of these: 59770 ( 1.49%) trimmed reads available after processing 3939693 (98.51%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 7 0.00% 20 5 0.00% 21 0 0.00% 22 1 0.00% 23 2 0.00% 24 1 0.00% 25 1 0.00% 26 2 0.00% 27 3 0.00% 28 5 0.00% 29 6 0.00% 30 6 0.00% 31 10 0.00% 32 12 0.00% 33 11 0.00% 34 11 0.00% 35 15 0.00% 36 18 0.00% 37 17 0.00% 38 33 0.00% 39 39 0.00% 40 59 0.00% 41 53 0.00% 42 91 0.00% 43 118 0.00% 44 162 0.00% 45 252 0.01% 46 348 0.01% 47 501 0.01% 48 913 0.02% 49 1944 0.05% 50 6084 0.15% 51 49026 1.23% 52 3939693 98.51% 3999463 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=34 prefix-density=0.21 prefix-fanout=2.0 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=16.07 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=1.8 sequence=GAGCTTTTCACACCAATGGTTACAATGAGTAGGAGAGGACTGGAAAGGGGTTCAGAGGGGGGTCTATTCCTATCCCCAAACAGGCAAGAATGAGCCCTAATGAAATTTAAGGCTGGTCAAGATATTGTTGTGGACAGGATCGGCCAGGTGATCCAGGAGGTTTTGGTATGGTCCGACTCCGGTCACGAGACCTTGCACAAAGTAACCCAAGATGGCCAACATAGC Started job on | Feb 13 12:26:02 Started mapping on | Feb 13 12:26:02 Finished on | Feb 13 12:26:07 Mapping speed, Million of reads per hour | 2879.61 Number of input reads | 3999463 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3650596 Uniquely mapped reads % | 91.28% Average mapped length | 51.84 Number of splices: Total | 476458 Number of splices: Annotated (sjdb) | 471317 Number of splices: GT/AG | 468117 Number of splices: GC/AG | 7636 Number of splices: AT/AC | 243 Number of splices: Non-canonical | 462 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 269330 % of reads mapped to multiple loci | 6.73% Number of reads mapped to too many loci | 67051 % of reads mapped to too many loci | 1.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.31% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 79537 79537 79537 N_multimapping 269330 269330 269330 N_noFeature 126547 3610083 143385 N_ambiguous 44325 37 20628 UnstrandedReadsAssigned:3479724 PositiveStrandReadsAssigned:40476 NegativeStrandReadsAssigned:3486583 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423513 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423513-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,463 reads, 3,664,923 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,030 rounds 52401 SRR5423513.ke.tsv 34699 SRR5423513.se.tsv 87100 total ==> SRR5423513.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 61 8.87581 Potri.005G024800.1.v4.1 1035 936 8.00643 2.38845 Potri.004G059700.1.v4.1 961 862 12 3.88711 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 33.3803 3.27728 Potri.016G087400.1.v4.1 270 171 89 145.327 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 112 35.6186 ==> SRR5423513.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 75 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR5423513 completed mapping pipeline successfully