Starting /dee2/code/volunteer_pipeline.sh SRR5423514 current disk space = 3092186529792 free memory = 1409684844 SRR5423514 SRAfilesize bee9072718bbe55157de306de4ffe904 SRR5423514.sra SRR5423514.sra file validated SRR5423514 is single end SRR5423514 is conventional basespace SRR5423514 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423514_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.31025 34.0 31.0 34.0 30.0 34.0 2 32.43 34.0 31.0 34.0 30.0 34.0 3 32.53125 34.0 31.0 34.0 30.0 34.0 4 35.962 37.0 35.0 37.0 35.0 37.0 5 35.9035 37.0 35.0 37.0 35.0 37.0 6 35.953 37.0 35.0 37.0 35.0 37.0 7 36.051 37.0 35.0 37.0 35.0 37.0 8 35.96175 37.0 35.0 37.0 35.0 37.0 9 37.734 39.0 38.0 39.0 35.0 39.0 10 37.541 39.0 37.0 39.0 35.0 39.0 11 37.6475 39.0 37.0 39.0 35.0 39.0 12 37.717 39.0 37.0 39.0 35.0 39.0 13 37.501 39.0 37.0 39.0 35.0 39.0 14 38.9385 40.0 38.0 41.0 35.0 41.0 15 38.948 40.0 38.0 41.0 36.0 41.0 16 38.906 40.0 38.0 41.0 35.0 41.0 17 38.98275 40.0 38.0 41.0 36.0 41.0 18 38.85225 40.0 38.0 41.0 35.0 41.0 19 38.86575 40.0 38.0 41.0 35.0 41.0 20 38.86725 40.0 38.0 41.0 35.0 41.0 21 38.9315 40.0 38.0 41.0 35.0 41.0 22 38.85725 40.0 38.0 41.0 35.0 41.0 23 38.844 40.0 38.0 41.0 35.0 41.0 24 38.6925 40.0 38.0 41.0 34.0 41.0 25 38.92775 40.0 38.0 41.0 35.0 41.0 26 38.8715 40.0 38.0 41.0 35.0 41.0 27 38.81 40.0 38.0 41.0 35.0 41.0 28 38.8245 40.0 38.0 41.0 35.0 41.0 29 38.707 40.0 38.0 41.0 35.0 41.0 30 38.7695 40.0 38.0 41.0 35.0 41.0 31 38.658 40.0 38.0 41.0 35.0 41.0 32 38.58275 40.0 38.0 41.0 34.0 41.0 33 38.518 40.0 38.0 41.0 34.0 41.0 34 38.428 40.0 38.0 41.0 34.0 41.0 35 38.41125 40.0 38.0 41.0 34.0 41.0 36 38.38075 40.0 38.0 41.0 34.0 41.0 37 38.371 40.0 38.0 41.0 34.0 41.0 38 38.21775 40.0 38.0 41.0 34.0 41.0 39 38.125 40.0 38.0 41.0 33.0 41.0 40 38.07225 40.0 38.0 41.0 33.0 41.0 41 38.1565 40.0 38.0 41.0 33.0 41.0 42 38.0665 40.0 38.0 41.0 33.0 41.0 43 38.11825 40.0 38.0 41.0 33.0 41.0 44 38.05375 40.0 38.0 41.0 33.0 41.0 45 37.88075 40.0 37.0 41.0 33.0 41.0 46 37.7575 40.0 37.0 41.0 33.0 41.0 47 37.60275 40.0 37.0 41.0 32.0 41.0 48 37.50725 40.0 37.0 41.0 32.0 41.0 49 37.72875 40.0 37.0 41.0 33.0 41.0 50 37.77775 40.0 37.0 41.0 33.0 41.0 51 37.7695 40.0 37.0 41.0 33.0 41.0 52 36.25825 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1306 1 0.0 1306 2 0.0 1306 3 0.0 1306 4 0.0 1306 5 0.0 1306 6 0.0 1306 7 0.0 1306 8 0.0 1306 9 0.0 1306 10 0.0 1306 11 0.0 1306 12 0.0 1306 13 0.0 1306 14 0.0 1306 15 0.0 1306 16 0.0 1306 17 0.0 1306 18 0.0 1306 19 0.0 1306 20 0.0 1306 21 0.0 1306 22 0.0 1306 23 0.0 1306 24 0.0 1306 25 0.0 1306 26 0.0 1306 27 0.0 1306 28 0.0 1306 29 0.0 1306 30 0.0 1306 31 0.0 1306 32 0.0 1306 33 0.0 1306 34 0.0 1306 35 0.0 1306 36 0.0 1306 37 0.0 1306 38 0.0 1306 39 0.0 1306 40 0.0 1306 41 0.0 1306 42 0.0 1306 43 0.0 1306 44 0.0 1306 45 0.0 1306 46 0.0 1306 47 0.0 1306 48 0.0 1306 49 0.0 1306 50 0.0 1306 51 0.0 1306 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 6.0 25 6.0 26 8.0 27 21.0 28 24.0 29 36.0 30 42.0 31 62.0 32 83.0 33 112.0 34 137.0 35 172.0 36 255.0 37 437.0 38 743.0 39 1835.0 40 14.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.13555499874718 13.630669005261838 5.412177399148083 31.821598596842897 2 21.575 16.225 35.65 26.55 3 17.8 21.675 28.975 31.55 4 24.224999999999998 28.775000000000002 22.45 24.55 5 23.400000000000002 33.7 23.0 19.900000000000002 6 19.400000000000002 32.525 23.974999999999998 24.099999999999998 7 15.575 21.275 42.225 20.925 8 18.224999999999998 20.525 31.175000000000004 30.075000000000003 9 18.975 18.65 32.5 29.875 10 19.650000000000002 36.5 23.7 20.150000000000002 11 26.025 24.95 20.875 28.15 12 22.575 20.775 25.55 31.1 13 21.125 26.400000000000002 27.125 25.35 14 22.900000000000002 25.324999999999996 26.35 25.424999999999997 15 21.349999999999998 25.5 26.174999999999997 26.974999999999998 16 22.0 27.1 26.325 24.575 17 22.2 25.75 26.575 25.474999999999998 18 21.9 24.375 26.5 27.224999999999998 19 22.95 26.474999999999998 24.45 26.125 20 22.55 25.275 26.1 26.075 21 22.625 25.650000000000002 25.6 26.125 22 23.200000000000003 25.2 25.650000000000002 25.95 23 21.349999999999998 25.424999999999997 25.7 27.525 24 21.075 25.8 26.575 26.55 25 22.05 25.35 25.674999999999997 26.924999999999997 26 21.7 25.374999999999996 26.55 26.375 27 22.325 24.474999999999998 25.424999999999997 27.775 28 21.525 25.825 26.674999999999997 25.974999999999998 29 22.925 24.45 25.874999999999996 26.75 30 21.5 24.425 26.174999999999997 27.900000000000002 31 22.525000000000002 26.224999999999998 24.8 26.450000000000003 32 21.975 25.0 26.125 26.900000000000002 33 22.85 23.674999999999997 25.2 28.275 34 22.95 24.55 26.275 26.224999999999998 35 23.0 25.474999999999998 26.075 25.45 36 22.2 25.45 25.025 27.325 37 21.75 25.424999999999997 25.074999999999996 27.750000000000004 38 22.325 23.325000000000003 27.55 26.8 39 22.55 24.425 26.674999999999997 26.35 40 22.675 25.374999999999996 25.074999999999996 26.875 41 23.925 25.4 25.35 25.324999999999996 42 21.75 24.625 26.35 27.275 43 22.875 24.725 26.174999999999997 26.224999999999998 44 21.975 24.95 26.575 26.5 45 22.675 24.375 25.650000000000002 27.3 46 22.8 25.624999999999996 25.35 26.224999999999998 47 22.125 24.825 26.325 26.724999999999998 48 22.305576394098527 23.58089522380595 25.881470367591895 28.232058014503625 49 23.9 24.85 24.575 26.674999999999997 50 21.85 24.775 26.200000000000003 27.175 51 21.655413853463365 24.031007751937985 26.131532883220803 28.182045511377847 52 23.0 25.074999999999996 24.975 26.950000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 3.0 18 1.5 19 0.0 20 1.5 21 3.0 22 3.5 23 4.0 24 6.5 25 9.0 26 11.5 27 14.0 28 22.5 29 31.0 30 37.0 31 43.0 32 51.5 33 60.0 34 61.0 35 62.0 36 78.0 37 94.0 38 106.0 39 154.0 40 190.0 41 207.0 42 224.0 43 262.0 44 300.0 45 314.0 46 328.0 47 358.0 48 388.0 49 400.0 50 412.0 51 414.5 52 417.0 53 398.0 54 379.0 55 326.5 56 274.0 57 255.5 58 237.0 59 198.0 60 159.0 61 139.0 62 119.0 63 87.0 64 41.0 65 27.0 66 26.0 67 25.0 68 15.5 69 6.0 70 8.0 71 10.0 72 7.5 73 5.0 74 3.0 75 1.0 76 0.5 77 0.0 78 1.0 79 2.0 80 1.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.57043163608168 94.375 2 1.8867924528301887 3.65 3 0.33600413543551305 0.975 4 0.10338588782631171 0.4 5 0.025846471956577927 0.125 6 0.051692943913155855 0.3 7 0.025846471956577927 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAAT 7 0.17500000000000002 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 6 0.15 No Hit GCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGG 6 0.15 No Hit GCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra Read 200000 spots for SRR5423514.sra Written 200000 spots for SRR5423514.sra SRR ids: ['SRR5423514.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ljlrl83y SRR5423514.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423514 file size 703958 SRR5423514 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423514 SRR5423514_1.fastq Input file: SRR5423514_1.fastq trimmed: SRR5423514-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:25:56 2025 >> started Thu Feb 13 12:25:58 2025 >> done (1.823s) 4000000 reads processed; of these: 210 ( 0.01%) short reads filtered out after trimming by size control 307 ( 0.01%) empty reads filtered out after trimming by size control 3999483 (99.99%) reads available; of these: 54135 ( 1.35%) trimmed reads available after processing 3945348 (98.65%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 8 0.00% 20 10 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 3 0.00% 27 5 0.00% 28 5 0.00% 29 2 0.00% 30 5 0.00% 31 4 0.00% 32 10 0.00% 33 11 0.00% 34 5 0.00% 35 8 0.00% 36 19 0.00% 37 14 0.00% 38 13 0.00% 39 30 0.00% 40 31 0.00% 41 59 0.00% 42 65 0.00% 43 75 0.00% 44 134 0.00% 45 187 0.00% 46 251 0.01% 47 422 0.01% 48 761 0.02% 49 1670 0.04% 50 5594 0.14% 51 44722 1.12% 52 3945348 98.65% 3999483 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.89 fanout-score-rank=33 prefix-density=0.22 prefix-fanout=1.9 sequence=GTCAAGTAGGATGGGGGCTCACC criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=12.82 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=3.5 sequence=GAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCCGTAGGCTTGTCACTGGCACCCGGCGAGTAAACGATGTGCTGACCATGGCGCTGGAGAGGGC Started job on | Feb 13 12:26:09 Started mapping on | Feb 13 12:26:09 Finished on | Feb 13 12:26:14 Mapping speed, Million of reads per hour | 2879.63 Number of input reads | 3999483 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3650270 Uniquely mapped reads % | 91.27% Average mapped length | 51.84 Number of splices: Total | 476476 Number of splices: Annotated (sjdb) | 471317 Number of splices: GT/AG | 467886 Number of splices: GC/AG | 7906 Number of splices: AT/AC | 249 Number of splices: Non-canonical | 435 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.00% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 269582 % of reads mapped to multiple loci | 6.74% Number of reads mapped to too many loci | 67088 % of reads mapped to too many loci | 1.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.31% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 79631 79631 79631 N_multimapping 269582 269582 269582 N_noFeature 126898 3609611 143655 N_ambiguous 44767 45 20842 UnstrandedReadsAssigned:3478605 PositiveStrandReadsAssigned:40614 NegativeStrandReadsAssigned:3485773 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423514 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423514-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,483 reads, 3,664,221 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52401 SRR5423514.ke.tsv 34699 SRR5423514.se.tsv 87100 total ==> SRR5423514.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 62 9.01015 Potri.005G024800.1.v4.1 1035 936 14 4.17126 Potri.004G059700.1.v4.1 961 862 8 2.5882 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 33.5545 3.2903 Potri.016G087400.1.v4.1 270 171 99 161.456 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.166594 Potri.012G127500.1.v4.1 977 878 124 39.386 ==> SRR5423514.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 84 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR5423514 completed mapping pipeline successfully