Starting /dee2/code/volunteer_pipeline.sh SRR5423515 current disk space = 3092666179584 free memory = 1391167828 SRR5423515 SRAfilesize df0bb180c4c31a615cb99f4484bd8c61 SRR5423515.sra SRR5423515.sra file validated SRR5423515 is single end SRR5423515 is conventional basespace SRR5423515 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423515_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71025 34.0 31.0 34.0 31.0 34.0 2 32.8425 34.0 31.0 34.0 31.0 34.0 3 32.853 34.0 31.0 34.0 31.0 34.0 4 36.20075 37.0 37.0 37.0 35.0 37.0 5 36.23975 37.0 37.0 37.0 35.0 37.0 6 36.1965 37.0 37.0 37.0 35.0 37.0 7 36.2245 37.0 37.0 37.0 35.0 37.0 8 36.2155 37.0 37.0 37.0 35.0 37.0 9 38.03025 39.0 38.0 39.0 37.0 39.0 10 37.8705 39.0 38.0 39.0 35.0 39.0 11 37.98575 39.0 38.0 39.0 35.0 39.0 12 37.97625 39.0 38.0 39.0 35.0 39.0 13 37.9385 39.0 38.0 39.0 35.0 39.0 14 39.497 41.0 39.0 41.0 37.0 41.0 15 39.42425 41.0 39.0 41.0 36.0 41.0 16 39.3695 41.0 39.0 41.0 36.0 41.0 17 39.33375 41.0 39.0 41.0 36.0 41.0 18 39.2735 40.0 39.0 41.0 36.0 41.0 19 39.39525 41.0 39.0 41.0 36.0 41.0 20 39.44875 41.0 39.0 41.0 36.0 41.0 21 39.3405 41.0 39.0 41.0 36.0 41.0 22 39.34325 41.0 39.0 41.0 36.0 41.0 23 39.363 41.0 39.0 41.0 36.0 41.0 24 39.307 41.0 39.0 41.0 36.0 41.0 25 39.2935 41.0 39.0 41.0 36.0 41.0 26 39.32275 41.0 39.0 41.0 36.0 41.0 27 39.2465 41.0 39.0 41.0 36.0 41.0 28 39.21525 40.0 39.0 41.0 36.0 41.0 29 39.13675 40.0 39.0 41.0 36.0 41.0 30 39.03875 40.0 39.0 41.0 36.0 41.0 31 39.12025 40.0 39.0 41.0 36.0 41.0 32 39.08075 40.0 39.0 41.0 36.0 41.0 33 39.0695 40.0 39.0 41.0 36.0 41.0 34 39.0295 40.0 39.0 41.0 36.0 41.0 35 38.96025 40.0 39.0 41.0 35.0 41.0 36 38.86625 40.0 38.0 41.0 35.0 41.0 37 38.69125 40.0 38.0 41.0 35.0 41.0 38 38.688 40.0 38.0 41.0 35.0 41.0 39 38.5655 40.0 38.0 41.0 34.0 41.0 40 38.64025 40.0 38.0 41.0 35.0 41.0 41 38.63475 40.0 38.0 41.0 35.0 41.0 42 38.5165 40.0 38.0 41.0 34.0 41.0 43 38.4905 40.0 38.0 41.0 34.0 41.0 44 38.4395 40.0 38.0 41.0 34.0 41.0 45 38.3155 40.0 38.0 41.0 34.0 41.0 46 38.328 40.0 38.0 41.0 34.0 41.0 47 38.194 40.0 38.0 41.0 33.0 41.0 48 38.05475 40.0 38.0 41.0 33.0 41.0 49 38.0345 40.0 37.0 41.0 33.0 41.0 50 38.05 40.0 37.0 41.0 33.0 41.0 51 37.9405 40.0 37.0 41.0 33.0 41.0 52 36.418 39.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2102 1 0.0 2102 2 0.0 2102 3 0.0 2102 4 0.0 2102 5 0.0 2102 6 0.0 2102 7 0.0 2102 8 0.0 2102 9 0.0 2102 10 0.0 2102 11 0.0 2102 12 0.0 2102 13 0.0 2102 14 0.0 2102 15 0.0 2102 16 0.0 2102 17 0.0 2102 18 0.0 2102 19 0.0 2102 20 0.0 2102 21 0.0 2102 22 0.0 2102 23 0.0 2102 24 0.0 2102 25 0.0 2102 26 0.0 2102 27 0.0 2102 28 0.0 2102 29 0.0 2102 30 0.0 2102 31 0.0 2102 32 0.0 2102 33 0.0 2102 34 0.0 2102 35 0.0 2102 36 0.0 2102 37 0.0 2102 38 0.0 2102 39 0.0 2102 40 0.0 2102 41 0.0 2102 42 0.0 2102 43 0.0 2102 44 0.0 2102 45 0.0 2102 46 0.0 2102 47 0.0 2102 48 0.0 2102 49 0.0 2102 50 0.0 2102 51 0.0 2102 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 1.0 23 2.0 24 2.0 25 2.0 26 7.0 27 7.0 28 15.0 29 27.0 30 34.0 31 46.0 32 52.0 33 94.0 34 111.0 35 145.0 36 227.0 37 334.0 38 702.0 39 2178.0 40 10.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.53715286464849 13.760320240180135 4.80360270202652 31.898924193144857 2 24.0 14.549999999999999 35.625 25.825 3 19.6 20.724999999999998 26.775 32.9 4 24.625 28.549999999999997 22.625 24.2 5 23.95 32.824999999999996 22.900000000000002 20.325 6 19.875 32.975 22.3 24.85 7 15.8 21.575 42.025 20.599999999999998 8 17.150000000000002 20.375 29.849999999999998 32.625 9 18.95 19.725 31.175000000000004 30.15 10 19.375 36.95 22.900000000000002 20.775 11 25.8 24.375 21.05 28.775000000000002 12 22.25 21.325 26.325 30.099999999999998 13 20.65 25.45 27.85 26.05 14 20.525 25.95 29.025000000000002 24.5 15 22.075 24.2 26.825 26.900000000000002 16 21.95 25.95 26.224999999999998 25.874999999999996 17 22.05 24.55 27.450000000000003 25.95 18 23.150000000000002 23.9 25.525 27.425 19 22.575 26.8 23.9 26.724999999999998 20 21.925 25.424999999999997 26.375 26.275 21 21.725 24.099999999999998 27.150000000000002 27.025 22 21.575 26.674999999999997 25.75 26.0 23 23.030757689422355 23.730932733183295 27.231807951987996 26.006501625406354 24 22.85 22.85 27.025 27.275 25 23.150000000000002 25.074999999999996 25.374999999999996 26.400000000000002 26 23.150000000000002 24.224999999999998 26.325 26.3 27 21.65 25.8 25.7 26.85 28 23.599999999999998 24.15 26.0 26.25 29 22.675 25.525 26.424999999999997 25.374999999999996 30 21.8 24.15 26.075 27.975 31 21.3 26.55 25.074999999999996 27.075 32 23.1 24.25 25.6 27.05 33 22.15 23.674999999999997 27.1 27.075 34 22.425 24.6 25.624999999999996 27.35 35 23.599999999999998 23.9 25.374999999999996 27.125 36 21.975 26.05 23.375 28.599999999999998 37 22.575 25.8 25.525 26.1 38 22.35 25.1 25.900000000000002 26.650000000000002 39 21.775 23.549999999999997 26.174999999999997 28.499999999999996 40 23.025000000000002 27.05 24.55 25.374999999999996 41 22.825 24.025 26.575 26.575 42 21.625 23.25 26.825 28.299999999999997 43 21.875 24.15 26.1 27.875 44 22.125 23.925 27.125 26.825 45 23.025000000000002 24.349999999999998 26.275 26.35 46 23.525 25.074999999999996 23.9 27.500000000000004 47 22.85 25.025 26.450000000000003 25.674999999999997 48 21.73043260815204 23.13078269567392 26.581645411352838 28.557139284821204 49 23.075000000000003 24.575 25.2 27.150000000000002 50 23.625 24.3 26.1 25.974999999999998 51 22.475 23.549999999999997 25.724999999999998 28.249999999999996 52 24.474999999999998 23.75 24.975 26.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 2.0 22 3.0 23 4.0 24 6.5 25 9.0 26 11.5 27 14.0 28 16.0 29 18.0 30 24.0 31 30.0 32 29.5 33 29.0 34 45.0 35 61.0 36 86.0 37 111.0 38 116.5 39 142.0 40 162.0 41 214.0 42 266.0 43 273.0 44 280.0 45 303.0 46 326.0 47 358.0 48 390.0 49 400.0 50 410.0 51 416.0 52 422.0 53 388.5 54 355.0 55 326.0 56 297.0 57 285.0 58 273.0 59 229.0 60 185.0 61 134.0 62 83.0 63 67.5 64 45.5 65 39.0 66 31.5 67 24.0 68 19.0 69 14.0 70 11.5 71 9.0 72 6.0 73 3.0 74 3.5 75 4.0 76 3.0 77 2.0 78 2.0 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.025 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.575 #Duplication Level Percentage of deduplicated Percentage of total 1 97.3595651048408 94.025 2 2.1485891793942535 4.15 3 0.3106393994304944 0.8999999999999999 4 0.0776598498576236 0.3 5 0.0776598498576236 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025886616619207874 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 10 0.25 No Hit GCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCA 5 0.125 No Hit GCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGG 5 0.125 No Hit GTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra Read 200000 spots for SRR5423515.sra Written 200000 spots for SRR5423515.sra SRR ids: ['SRR5423515.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qv4oh8c6 SRR5423515.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423515 file size 704009 SRR5423515 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423515 SRR5423515_1.fastq Input file: SRR5423515_1.fastq trimmed: SRR5423515-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:08:59 2025 >> started Thu Feb 13 12:09:01 2025 >> done (2.007s) 4000000 reads processed; of these: 235 ( 0.01%) short reads filtered out after trimming by size control 309 ( 0.01%) empty reads filtered out after trimming by size control 3999456 (99.99%) reads available; of these: 50680 ( 1.27%) trimmed reads available after processing 3948776 (98.73%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 10 0.00% 20 7 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 3 0.00% 25 4 0.00% 26 4 0.00% 27 1 0.00% 28 2 0.00% 29 5 0.00% 30 10 0.00% 31 8 0.00% 32 8 0.00% 33 16 0.00% 34 13 0.00% 35 11 0.00% 36 15 0.00% 37 24 0.00% 38 35 0.00% 39 31 0.00% 40 58 0.00% 41 64 0.00% 42 81 0.00% 43 118 0.00% 44 154 0.00% 45 275 0.01% 46 345 0.01% 47 525 0.01% 48 867 0.02% 49 1803 0.05% 50 5553 0.14% 51 40616 1.02% 52 3948776 98.73% 3999456 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=32 prefix-density=0.22 prefix-fanout=2.0 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=12.60 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=3.5 sequence=GAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCCGTAGGCTTGTCACTGGCACCCGGCGAGTAAACGATGTGCTGACCATGGCGCTGGAGAGGGC Started job on | Feb 13 12:09:15 Started mapping on | Feb 13 12:09:15 Finished on | Feb 13 12:09:20 Mapping speed, Million of reads per hour | 2879.61 Number of input reads | 3999456 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3650350 Uniquely mapped reads % | 91.27% Average mapped length | 51.84 Number of splices: Total | 475510 Number of splices: Annotated (sjdb) | 470298 Number of splices: GT/AG | 467020 Number of splices: GC/AG | 7861 Number of splices: AT/AC | 214 Number of splices: Non-canonical | 415 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.00% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 270021 % of reads mapped to multiple loci | 6.75% Number of reads mapped to too many loci | 66189 % of reads mapped to too many loci | 1.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.32% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 79085 79085 79085 N_multimapping 270021 270021 270021 N_noFeature 125483 3609893 142294 N_ambiguous 44294 49 20619 UnstrandedReadsAssigned:3480573 PositiveStrandReadsAssigned:40408 NegativeStrandReadsAssigned:3487437 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423515 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423515-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,456 reads, 3,656,737 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 SRR5423515.ke.tsv 34699 SRR5423515.se.tsv 87100 total ==> SRR5423515.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 70 10.1916 Potri.005G024800.1.v4.1 1035 936 9 2.68648 Potri.004G059700.1.v4.1 961 862 11 3.56536 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 45.2412 4.44449 Potri.016G087400.1.v4.1 270 171 91 148.684 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1.58041 0.263775 Potri.012G127500.1.v4.1 977 878 115 36.5949 ==> SRR5423515.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 61 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423515 completed mapping pipeline successfully