Starting /dee2/code/volunteer_pipeline.sh SRR5423516 current disk space = 3091738759168 free memory = 1408023800 SRR5423516 SRAfilesize cde375e2a8c2fc6a71548d08a14bbe35 SRR5423516.sra SRR5423516.sra file validated SRR5423516 is single end SRR5423516 is conventional basespace SRR5423516 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423516_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4485 31.0 31.0 34.0 28.0 34.0 2 31.76025 31.0 31.0 34.0 30.0 34.0 3 31.937 33.0 31.0 34.0 30.0 34.0 4 32.44825 35.0 32.0 37.0 19.0 37.0 5 34.60575 35.0 35.0 37.0 30.0 37.0 6 35.086 37.0 35.0 37.0 32.0 37.0 7 35.515 37.0 35.0 37.0 33.0 37.0 8 35.605 37.0 35.0 37.0 33.0 37.0 9 37.23325 39.0 37.0 39.0 34.0 39.0 10 37.076 39.0 37.0 39.0 33.0 39.0 11 37.141 39.0 37.0 39.0 33.0 39.0 12 37.1265 39.0 37.0 39.0 33.0 39.0 13 37.30675 39.0 37.0 39.0 34.0 39.0 14 38.6275 40.0 38.0 41.0 34.0 41.0 15 38.27 40.0 38.0 41.0 33.0 41.0 16 38.415 40.0 38.0 41.0 34.0 41.0 17 38.4665 40.0 38.0 41.0 34.0 41.0 18 38.35175 40.0 38.0 41.0 33.0 41.0 19 38.452 40.0 38.0 41.0 34.0 41.0 20 38.459 40.0 38.0 41.0 34.0 41.0 21 38.53025 40.0 38.0 41.0 34.0 41.0 22 38.4675 40.0 38.0 41.0 34.0 41.0 23 38.32225 40.0 38.0 41.0 34.0 41.0 24 38.397 40.0 38.0 41.0 34.0 41.0 25 38.329 40.0 38.0 41.0 34.0 41.0 26 38.29825 40.0 38.0 41.0 34.0 41.0 27 38.3835 40.0 38.0 41.0 34.0 41.0 28 38.2845 40.0 38.0 41.0 34.0 41.0 29 38.24575 40.0 38.0 41.0 34.0 41.0 30 38.09125 40.0 38.0 41.0 33.0 41.0 31 38.09825 40.0 38.0 41.0 33.0 41.0 32 38.164 40.0 38.0 41.0 34.0 41.0 33 38.08925 40.0 38.0 41.0 33.0 41.0 34 37.9795 40.0 38.0 41.0 33.0 41.0 35 38.02175 40.0 37.0 41.0 33.0 41.0 36 37.95575 40.0 37.0 41.0 33.0 41.0 37 38.002 40.0 37.0 41.0 33.0 41.0 38 37.93275 40.0 37.0 41.0 33.0 41.0 39 37.90825 40.0 37.0 41.0 33.0 41.0 40 37.7365 40.0 37.0 41.0 32.0 41.0 41 37.86725 40.0 37.0 41.0 33.0 41.0 42 37.7905 40.0 37.0 41.0 33.0 41.0 43 37.78875 40.0 37.0 41.0 33.0 41.0 44 37.62125 40.0 37.0 41.0 32.0 41.0 45 37.526 40.0 37.0 41.0 32.0 41.0 46 37.2905 40.0 36.0 41.0 31.0 41.0 47 37.31825 39.0 36.0 41.0 31.0 41.0 48 37.32175 39.0 36.0 41.0 31.0 41.0 49 37.141 39.0 36.0 41.0 31.0 41.0 50 37.3635 39.0 36.0 41.0 31.0 41.0 51 37.322 39.0 36.0 41.0 31.0 41.0 52 36.396 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2114 1 0.0 2114 2 0.0 2114 3 0.0 2114 4 0.0 2114 5 0.0 2114 6 0.0 2114 7 0.0 2114 8 0.0 2114 9 0.0 2114 10 0.0 2114 11 0.0 2114 12 0.0 2114 13 0.0 2114 14 0.0 2114 15 0.0 2114 16 0.0 2114 17 0.0 2114 18 0.0 2114 19 0.0 2114 20 0.0 2114 21 0.0 2114 22 0.0 2114 23 0.0 2114 24 0.0 2114 25 0.0 2114 26 0.0 2114 27 0.0 2114 28 0.0 2114 29 0.0 2114 30 0.0 2114 31 0.0 2114 32 0.0 2114 33 0.0 2114 34 0.0 2114 35 0.0 2114 36 0.0 2114 37 0.0 2114 38 0.0 2114 39 0.0 2114 40 0.0 2114 41 0.0 2114 42 0.0 2114 43 0.0 2114 44 0.0 2114 45 0.0 2114 46 0.0 2114 47 0.0 2114 48 0.0 2114 49 0.0 2114 50 0.0 2114 51 0.0 2114 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 4.0 22 3.0 23 3.0 24 7.0 25 8.0 26 7.0 27 25.0 28 22.0 29 44.0 30 69.0 31 86.0 32 118.0 33 144.0 34 185.0 35 221.0 36 363.0 37 494.0 38 808.0 39 1384.0 40 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 49.02451225612807 14.057028514257128 5.552776388194097 31.36568284142071 2 21.95 15.7 35.125 27.224999999999998 3 17.775 22.075 29.349999999999998 30.8 4 23.599999999999998 26.75 25.25 24.4 5 23.3 33.725 23.05 19.925 6 19.175 32.675 23.724999999999998 24.425 7 16.85 21.95 40.9 20.3 8 17.375 22.25 30.125 30.25 9 18.625 20.674999999999997 32.2 28.499999999999996 10 20.125 35.5 24.2 20.175 11 26.0 24.349999999999998 20.3 29.349999999999998 12 22.225 20.974999999999998 25.3 31.5 13 20.325 24.075 28.799999999999997 26.8 14 21.325 25.2 27.525 25.95 15 21.6 24.625 26.125 27.650000000000002 16 23.5 25.624999999999996 25.7 25.174999999999997 17 22.875 24.95 27.075 25.1 18 21.05 24.099999999999998 27.625 27.224999999999998 19 22.0 27.375 26.174999999999997 24.45 20 22.900000000000002 25.324999999999996 25.85 25.924999999999997 21 22.425 24.55 26.6 26.424999999999997 22 23.325000000000003 24.95 26.674999999999997 25.05 23 22.0 25.224999999999998 26.1 26.674999999999997 24 22.325 24.725 26.900000000000002 26.05 25 23.025000000000002 24.224999999999998 25.374999999999996 27.375 26 22.1 25.650000000000002 26.575 25.674999999999997 27 21.55 24.775 25.75 27.925 28 21.775 25.55 25.775 26.900000000000002 29 21.65 26.724999999999998 25.5 26.125 30 20.925 25.174999999999997 26.674999999999997 27.224999999999998 31 21.0 26.724999999999998 26.974999999999998 25.3 32 21.85 25.424999999999997 26.55 26.174999999999997 33 21.95 24.575 26.625 26.85 34 22.725 24.75 24.75 27.775 35 22.15 24.675 25.324999999999996 27.85 36 22.2 24.349999999999998 25.95 27.500000000000004 37 22.825 25.174999999999997 25.224999999999998 26.775 38 22.775000000000002 24.925 27.375 24.925 39 21.6 24.75 25.85 27.800000000000004 40 22.85 25.05 26.174999999999997 25.924999999999997 41 23.075000000000003 24.525 25.05 27.35 42 22.175 24.45 26.650000000000002 26.724999999999998 43 22.275 23.625 26.125 27.975 44 22.8 24.474999999999998 26.6 26.125 45 22.55 24.474999999999998 26.150000000000002 26.825 46 23.400000000000002 24.775 25.95 25.874999999999996 47 23.925 23.825 26.125 26.125 48 22.625 23.974999999999998 25.75 27.650000000000002 49 23.474999999999998 25.3 25.15 26.075 50 22.75 25.95 24.9 26.400000000000002 51 22.675 24.525 25.75 27.05 52 23.325000000000003 23.674999999999997 26.025 26.974999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 2.0 16 1.5 17 1.0 18 1.5 19 2.0 20 1.5 21 1.0 22 2.0 23 3.0 24 5.5 25 8.0 26 11.5 27 15.0 28 19.5 29 24.0 30 32.0 31 40.0 32 49.0 33 58.0 34 64.5 35 71.0 36 99.0 37 127.0 38 126.0 39 157.5 40 190.0 41 203.0 42 216.0 43 252.5 44 289.0 45 314.5 46 340.0 47 355.0 48 370.0 49 384.0 50 398.0 51 412.5 52 427.0 53 402.5 54 378.0 55 335.0 56 292.0 57 256.0 58 220.0 59 191.0 60 162.0 61 128.0 62 94.0 63 75.0 64 43.0 65 30.0 66 29.0 67 28.0 68 20.0 69 12.0 70 10.5 71 9.0 72 8.5 73 8.0 74 5.0 75 2.0 76 1.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.28600665131746 96.05 2 1.253517523663341 2.45 3 0.33256587362496803 0.975 4 0.10232796111537479 0.4 5 0.025581990278843697 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra Read 200000 spots for SRR5423516.sra Written 200000 spots for SRR5423516.sra SRR ids: ['SRR5423516.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_omgk5vk3 SRR5423516.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423516 file size 703961 SRR5423516 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423516 SRR5423516_1.fastq Input file: SRR5423516_1.fastq trimmed: SRR5423516-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:42:02 2025 >> started Thu Feb 13 12:42:04 2025 >> done (1.973s) 4000000 reads processed; of these: 230 ( 0.01%) short reads filtered out after trimming by size control 295 ( 0.01%) empty reads filtered out after trimming by size control 3999475 (99.99%) reads available; of these: 65348 ( 1.63%) trimmed reads available after processing 3934127 (98.37%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 8 0.00% 20 7 0.00% 21 2 0.00% 22 1 0.00% 23 0 0.00% 24 5 0.00% 25 6 0.00% 26 3 0.00% 27 2 0.00% 28 5 0.00% 29 10 0.00% 30 8 0.00% 31 10 0.00% 32 25 0.00% 33 22 0.00% 34 17 0.00% 35 22 0.00% 36 26 0.00% 37 40 0.00% 38 46 0.00% 39 60 0.00% 40 70 0.00% 41 104 0.00% 42 114 0.00% 43 192 0.00% 44 254 0.01% 45 331 0.01% 46 549 0.01% 47 793 0.02% 48 1264 0.03% 49 2783 0.07% 50 7422 0.19% 51 51136 1.28% 52 3934127 98.37% 3999475 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=36 prefix-density=0.21 prefix-fanout=2.0 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=12.26 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=3.5 sequence=GAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCCGTAGGCTTGTCACTGGCACCCGGCGAGTAAACGATGTGCTGACCATGGCGCTGGAGAGGGC Started job on | Feb 13 12:42:17 Started mapping on | Feb 13 12:42:17 Finished on | Feb 13 12:42:21 Mapping speed, Million of reads per hour | 3599.53 Number of input reads | 3999475 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3650021 Uniquely mapped reads % | 91.26% Average mapped length | 51.83 Number of splices: Total | 476818 Number of splices: Annotated (sjdb) | 471653 Number of splices: GT/AG | 468241 Number of splices: GC/AG | 7836 Number of splices: AT/AC | 267 Number of splices: Non-canonical | 474 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 270126 % of reads mapped to multiple loci | 6.75% Number of reads mapped to too many loci | 65616 % of reads mapped to too many loci | 1.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.34% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 79328 79328 79328 N_multimapping 270126 270126 270126 N_noFeature 125089 3609410 141895 N_ambiguous 44508 38 20684 UnstrandedReadsAssigned:3480424 PositiveStrandReadsAssigned:40573 NegativeStrandReadsAssigned:3487442 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423516 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423516-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,475 reads, 3,663,569 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52401 SRR5423516.ke.tsv 34699 SRR5423516.se.tsv 87100 total ==> SRR5423516.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 63 9.19254 Potri.005G024800.1.v4.1 1035 936 8.00678 2.39526 Potri.004G059700.1.v4.1 961 862 11 3.57319 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 35.2082 3.46644 Potri.016G087400.1.v4.1 270 171 109 178.485 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 2 0.334537 Potri.012G127500.1.v4.1 977 878 97 30.9348 ==> SRR5423516.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 80 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR5423516 completed mapping pipeline successfully