Starting /dee2/code/volunteer_pipeline.sh SRR5423517 current disk space = 3091240861696 free memory = 1579810776 SRR5423517 SRAfilesize d456d66f4bf261b13ff204ae39dd2d12 SRR5423517.sra SRR5423517.sra file validated SRR5423517 is single end SRR5423517 is conventional basespace SRR5423517 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423517_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.10425 33.0 31.0 34.0 30.0 34.0 2 32.29425 34.0 31.0 34.0 30.0 34.0 3 32.3285 34.0 31.0 34.0 30.0 34.0 4 35.482 37.0 35.0 37.0 33.0 37.0 5 35.77525 37.0 35.0 37.0 33.0 37.0 6 35.78825 37.0 35.0 37.0 35.0 37.0 7 35.88975 37.0 35.0 37.0 35.0 37.0 8 35.8745 37.0 35.0 37.0 35.0 37.0 9 37.5405 39.0 37.0 39.0 35.0 39.0 10 37.3295 39.0 37.0 39.0 34.0 39.0 11 37.47875 39.0 37.0 39.0 34.0 39.0 12 37.4315 39.0 37.0 39.0 35.0 39.0 13 37.449 39.0 37.0 39.0 35.0 39.0 14 38.72525 40.0 38.0 41.0 34.0 41.0 15 38.826 40.0 38.0 41.0 35.0 41.0 16 38.743 40.0 38.0 41.0 35.0 41.0 17 38.74325 40.0 38.0 41.0 34.0 41.0 18 38.638 40.0 38.0 41.0 34.0 41.0 19 38.7525 40.0 38.0 41.0 34.0 41.0 20 38.59525 40.0 38.0 41.0 34.0 41.0 21 38.6755 40.0 38.0 41.0 34.0 41.0 22 38.6865 40.0 38.0 41.0 34.0 41.0 23 38.759 40.0 38.0 41.0 35.0 41.0 24 38.34475 40.0 38.0 41.0 33.0 41.0 25 38.6405 40.0 38.0 41.0 34.0 41.0 26 38.62825 40.0 38.0 41.0 34.0 41.0 27 38.537 40.0 38.0 41.0 34.0 41.0 28 38.50675 40.0 38.0 41.0 34.0 41.0 29 38.4665 40.0 38.0 41.0 34.0 41.0 30 38.426 40.0 38.0 41.0 34.0 41.0 31 38.425 40.0 38.0 41.0 34.0 41.0 32 38.46475 40.0 38.0 41.0 34.0 41.0 33 38.37 40.0 38.0 41.0 34.0 41.0 34 38.438 40.0 38.0 41.0 34.0 41.0 35 38.28825 40.0 38.0 41.0 33.0 41.0 36 38.0785 40.0 38.0 41.0 33.0 41.0 37 38.0945 40.0 38.0 41.0 33.0 41.0 38 38.12975 40.0 38.0 41.0 33.0 41.0 39 38.13725 40.0 38.0 41.0 33.0 41.0 40 37.9765 40.0 38.0 41.0 33.0 41.0 41 37.865 40.0 37.0 41.0 33.0 41.0 42 37.8755 40.0 37.0 41.0 33.0 41.0 43 37.77525 40.0 37.0 41.0 32.0 41.0 44 37.765 40.0 37.0 41.0 32.0 41.0 45 37.706 40.0 37.0 41.0 32.0 41.0 46 37.644 40.0 37.0 41.0 32.0 41.0 47 37.60125 40.0 37.0 41.0 32.0 41.0 48 37.48825 40.0 37.0 41.0 32.0 41.0 49 37.42825 40.0 36.0 41.0 31.0 41.0 50 37.4855 40.0 37.0 41.0 32.0 41.0 51 37.491 40.0 37.0 41.0 32.0 41.0 52 36.55475 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2211 1 0.0 2211 2 0.0 2211 3 0.0 2211 4 0.0 2211 5 0.0 2211 6 0.0 2211 7 0.0 2211 8 0.0 2211 9 0.0 2211 10 0.0 2211 11 0.0 2211 12 0.0 2211 13 0.0 2211 14 0.0 2211 15 0.0 2211 16 0.0 2211 17 0.0 2211 18 0.0 2211 19 0.0 2211 20 0.0 2211 21 0.0 2211 22 0.0 2211 23 0.0 2211 24 0.0 2211 25 0.0 2211 26 0.0 2211 27 0.0 2211 28 0.0 2211 29 0.0 2211 30 0.0 2211 31 0.0 2211 32 0.0 2211 33 0.0 2211 34 0.0 2211 35 0.0 2211 36 0.0 2211 37 0.0 2211 38 0.0 2211 39 0.0 2211 40 0.0 2211 41 0.0 2211 42 0.0 2211 43 0.0 2211 44 0.0 2211 45 0.0 2211 46 0.0 2211 47 0.0 2211 48 0.0 2211 49 0.0 2211 50 0.0 2211 51 0.0 2211 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 3.0 22 0.0 23 7.0 24 10.0 25 9.0 26 14.0 27 13.0 28 25.0 29 41.0 30 54.0 31 83.0 32 84.0 33 119.0 34 159.0 35 192.0 36 285.0 37 416.0 38 719.0 39 1756.0 40 10.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.93670252689517 13.0597948461346 5.42907180385289 32.57443082311734 2 22.325 15.6 36.175000000000004 25.900000000000002 3 20.175 20.65 27.650000000000002 31.525 4 23.35 29.799999999999997 22.5 24.349999999999998 5 22.85 33.1 23.275000000000002 20.775 6 19.85 32.550000000000004 22.925 24.675 7 16.85 21.65 40.725 20.775 8 17.625 20.175 30.975 31.225 9 18.775 20.0 31.474999999999998 29.75 10 20.599999999999998 35.425000000000004 23.599999999999998 20.375 11 25.575 25.25 20.724999999999998 28.449999999999996 12 23.125 20.575 24.925 31.374999999999996 13 21.099999999999998 27.075 25.974999999999998 25.85 14 20.974999999999998 26.5 26.474999999999998 26.05 15 21.325 26.05 25.424999999999997 27.200000000000003 16 22.175 25.4 26.474999999999998 25.95 17 22.2 25.374999999999996 26.325 26.1 18 22.325 24.525 26.174999999999997 26.974999999999998 19 23.125 26.375 25.2 25.3 20 22.55 26.150000000000002 26.200000000000003 25.1 21 21.925 25.6 25.75 26.724999999999998 22 22.95 25.45 25.674999999999997 25.924999999999997 23 21.675 26.5 25.85 25.974999999999998 24 20.95 25.6 26.075 27.375 25 22.45 25.7 26.325 25.525 26 21.65 24.25 26.424999999999997 27.675 27 21.349999999999998 24.7 26.150000000000002 27.800000000000004 28 22.125 25.174999999999997 26.55 26.150000000000002 29 21.55 24.525 27.1 26.825 30 22.725 24.175 26.650000000000002 26.450000000000003 31 23.35 24.95 25.5 26.200000000000003 32 22.6 25.2 25.25 26.950000000000003 33 22.1 24.525 26.6 26.775 34 22.725 24.4 26.525 26.35 35 23.075000000000003 23.375 25.874999999999996 27.675 36 22.225 25.324999999999996 24.675 27.775 37 23.150000000000002 25.174999999999997 24.425 27.250000000000004 38 21.65 24.975 25.900000000000002 27.474999999999998 39 22.7 24.85 25.75 26.700000000000003 40 21.675 25.85 24.8 27.675 41 21.7 26.0 25.174999999999997 27.125 42 23.35 23.400000000000002 25.15 28.1 43 23.200000000000003 25.3 25.025 26.474999999999998 44 21.875 23.5 27.325 27.3 45 23.549999999999997 23.35 26.325 26.775 46 22.48062015503876 25.70642660665166 25.256314078519633 26.556639159789945 47 22.88072018004501 24.90622655663916 25.681420355088775 26.531632908227053 48 22.080520130032507 24.50612653163291 25.30632658164541 28.107026756689173 49 22.9057264316079 25.431357839459867 24.956239059764943 26.70667666916729 50 22.475 24.05 26.75 26.724999999999998 51 22.725 23.1 26.924999999999997 27.250000000000004 52 22.35 24.85 25.2 27.6 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 2.0 21 3.0 22 1.5 23 0.0 24 4.5 25 9.0 26 9.0 27 9.0 28 18.0 29 27.0 30 31.5 31 36.0 32 42.5 33 49.0 34 63.5 35 78.0 36 87.0 37 96.0 38 112.5 39 154.5 40 180.0 41 203.5 42 227.0 43 260.0 44 293.0 45 306.5 46 320.0 47 354.0 48 388.0 49 396.0 50 404.0 51 401.5 52 399.0 53 390.5 54 382.0 55 352.5 56 323.0 57 274.0 58 225.0 59 191.0 60 157.0 61 132.0 62 107.0 63 83.5 64 48.5 65 37.0 66 28.5 67 20.0 68 19.0 69 18.0 70 13.5 71 9.0 72 6.5 73 4.0 74 4.0 75 4.0 76 3.5 77 3.0 78 1.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.025 48 0.025 49 0.025 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.2343909928352 95.975 2 1.4329580348004094 2.8000000000000003 3 0.17911975435005117 0.525 4 0.07676560900716478 0.3 5 0.0511770726714432 0.25 6 0.0255885363357216 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 6 0.15 No Hit GGGAAAGCTGAGGTAGACTTGAGGCCGTTGAATGGTGCAACCATGTTGGCCT 5 0.125 No Hit GGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra Read 200000 spots for SRR5423517.sra Written 200000 spots for SRR5423517.sra SRR ids: ['SRR5423517.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5y5ojzbu SRR5423517.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423517 file size 703964 SRR5423517 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423517 SRR5423517_1.fastq Input file: SRR5423517_1.fastq trimmed: SRR5423517-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:07:02 2025 >> started Thu Feb 13 13:07:04 2025 >> done (1.998s) 4000000 reads processed; of these: 230 ( 0.01%) short reads filtered out after trimming by size control 313 ( 0.01%) empty reads filtered out after trimming by size control 3999457 (99.99%) reads available; of these: 58699 ( 1.47%) trimmed reads available after processing 3940758 (98.53%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 5 0.00% 20 6 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 1 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 5 0.00% 29 6 0.00% 30 7 0.00% 31 11 0.00% 32 12 0.00% 33 13 0.00% 34 15 0.00% 35 12 0.00% 36 20 0.00% 37 33 0.00% 38 39 0.00% 39 48 0.00% 40 62 0.00% 41 94 0.00% 42 88 0.00% 43 143 0.00% 44 202 0.01% 45 311 0.01% 46 465 0.01% 47 599 0.01% 48 1069 0.03% 49 2228 0.06% 50 6563 0.16% 51 46617 1.17% 52 3940758 98.53% 3999457 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=35 prefix-density=0.21 prefix-fanout=2.0 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=12.88 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=3.5 sequence=GAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCCGTAGGCTTGTCACTGGCACCCGGCGAGTAAACGATGTGCTGACCATGGCGCTGGAGAGGGC Started job on | Feb 13 13:07:18 Started mapping on | Feb 13 13:07:18 Finished on | Feb 13 13:07:22 Mapping speed, Million of reads per hour | 3599.51 Number of input reads | 3999457 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3651080 Uniquely mapped reads % | 91.29% Average mapped length | 51.84 Number of splices: Total | 475883 Number of splices: Annotated (sjdb) | 470738 Number of splices: GT/AG | 467352 Number of splices: GC/AG | 7853 Number of splices: AT/AC | 252 Number of splices: Non-canonical | 426 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 268849 % of reads mapped to multiple loci | 6.72% Number of reads mapped to too many loci | 66145 % of reads mapped to too many loci | 1.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.33% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 79528 79528 79528 N_multimapping 268849 268849 268849 N_noFeature 126105 3610472 142855 N_ambiguous 44459 40 20580 UnstrandedReadsAssigned:3480516 PositiveStrandReadsAssigned:40568 NegativeStrandReadsAssigned:3487645 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423517 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423517-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,457 reads, 3,655,135 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR5423517.ke.tsv 34699 SRR5423517.se.tsv 87100 total ==> SRR5423517.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 68 9.9429 Potri.005G024800.1.v4.1 1035 936 9.01554 2.70268 Potri.004G059700.1.v4.1 961 862 6 1.95309 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 29.3193 2.8927 Potri.016G087400.1.v4.1 270 171 117 191.986 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 124 39.6284 ==> SRR5423517.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 76 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR5423517 completed mapping pipeline successfully