Starting /dee2/code/volunteer_pipeline.sh SRR5423518 current disk space = 3051999461376 free memory = 1481114328 SRR5423518 SRAfilesize 61eb46bb33a5ae183be78468ebf86320 SRR5423518.sra SRR5423518.sra file validated SRR5423518 is single end SRR5423518 is conventional basespace SRR5423518 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423518_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2945 34.0 31.0 34.0 30.0 34.0 2 32.44725 34.0 31.0 34.0 30.0 34.0 3 32.5935 34.0 31.0 34.0 31.0 34.0 4 35.9235 37.0 35.0 37.0 35.0 37.0 5 35.87075 37.0 35.0 37.0 35.0 37.0 6 36.02725 37.0 35.0 37.0 35.0 37.0 7 36.04575 37.0 35.0 37.0 35.0 37.0 8 35.98175 37.0 35.0 37.0 35.0 37.0 9 37.7335 39.0 38.0 39.0 35.0 39.0 10 37.684 39.0 37.0 39.0 35.0 39.0 11 37.8095 39.0 38.0 39.0 35.0 39.0 12 37.7225 39.0 38.0 39.0 35.0 39.0 13 37.575 39.0 37.0 39.0 35.0 39.0 14 38.76575 40.0 38.0 41.0 34.0 41.0 15 39.01175 40.0 38.0 41.0 36.0 41.0 16 38.94325 40.0 38.0 41.0 35.0 41.0 17 39.0305 40.0 38.0 41.0 36.0 41.0 18 38.8865 40.0 38.0 41.0 35.0 41.0 19 38.8685 40.0 38.0 41.0 35.0 41.0 20 38.8625 40.0 38.0 41.0 34.0 41.0 21 38.9065 40.0 38.0 41.0 35.0 41.0 22 38.808 40.0 38.0 41.0 35.0 41.0 23 38.88775 40.0 38.0 41.0 35.0 41.0 24 38.97325 40.0 38.0 41.0 35.0 41.0 25 38.731 40.0 38.0 41.0 34.0 41.0 26 38.7435 40.0 38.0 41.0 35.0 41.0 27 38.8235 40.0 38.0 41.0 35.0 41.0 28 38.72325 40.0 38.0 41.0 34.0 41.0 29 38.57125 40.0 38.0 41.0 34.0 41.0 30 38.59025 40.0 38.0 41.0 34.0 41.0 31 38.55175 40.0 38.0 41.0 34.0 41.0 32 38.58675 40.0 38.0 41.0 34.0 41.0 33 38.687 40.0 38.0 41.0 35.0 41.0 34 38.59525 40.0 38.0 41.0 34.0 41.0 35 38.46025 40.0 38.0 41.0 34.0 41.0 36 38.5575 40.0 38.0 41.0 34.0 41.0 37 38.4575 40.0 38.0 41.0 34.0 41.0 38 38.3015 40.0 38.0 41.0 33.0 41.0 39 38.3975 40.0 38.0 41.0 34.0 41.0 40 38.1745 40.0 38.0 41.0 33.0 41.0 41 38.086 40.0 38.0 41.0 33.0 41.0 42 38.094 40.0 38.0 41.0 33.0 41.0 43 38.0835 40.0 38.0 41.0 33.0 41.0 44 38.021 40.0 38.0 41.0 33.0 41.0 45 38.052 40.0 37.0 41.0 33.0 41.0 46 38.02425 40.0 37.0 41.0 33.0 41.0 47 37.90125 40.0 37.0 41.0 33.0 41.0 48 37.80225 40.0 37.0 41.0 33.0 41.0 49 37.69075 40.0 37.0 41.0 32.0 41.0 50 37.62025 40.0 37.0 41.0 32.0 41.0 51 37.367 40.0 36.0 41.0 32.0 41.0 52 36.38375 39.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2307 1 0.0 2307 2 0.0 2307 3 0.0 2307 4 0.0 2307 5 0.0 2307 6 0.0 2307 7 0.0 2307 8 0.0 2307 9 0.0 2307 10 0.0 2307 11 0.0 2307 12 0.0 2307 13 0.0 2307 14 0.0 2307 15 0.0 2307 16 0.0 2307 17 0.0 2307 18 0.0 2307 19 0.0 2307 20 0.0 2307 21 0.0 2307 22 0.0 2307 23 0.0 2307 24 0.0 2307 25 0.0 2307 26 0.0 2307 27 0.0 2307 28 0.0 2307 29 0.0 2307 30 0.0 2307 31 0.0 2307 32 0.0 2307 33 0.0 2307 34 0.0 2307 35 0.0 2307 36 0.0 2307 37 0.0 2307 38 0.0 2307 39 0.0 2307 40 0.0 2307 41 0.0 2307 42 0.0 2307 43 0.0 2307 44 0.0 2307 45 0.0 2307 46 0.0 2307 47 0.0 2307 48 0.0 2307 49 0.0 2307 50 0.0 2307 51 0.0 2307 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 7.0 25 11.0 26 12.0 27 15.0 28 23.0 29 34.0 30 45.0 31 71.0 32 94.0 33 100.0 34 125.0 35 190.0 36 266.0 37 357.0 38 732.0 39 1907.0 40 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.437077808356264 13.58518889166875 5.128846634976232 31.848886664998748 2 22.675 14.924999999999999 34.525 27.875 3 19.3 21.375 27.250000000000004 32.074999999999996 4 23.125 29.775000000000002 23.0 24.099999999999998 5 23.5 33.725 23.175 19.6 6 19.7 33.95 22.775000000000002 23.575 7 16.400000000000002 21.45 41.825 20.325 8 18.9 20.1 30.125 30.875000000000004 9 17.45 20.0 33.375 29.175 10 19.900000000000002 34.775 24.85 20.474999999999998 11 25.474999999999998 24.025 22.025 28.475 12 23.45 22.0 25.4 29.15 13 20.75 25.650000000000002 27.275 26.325 14 20.9 26.224999999999998 26.424999999999997 26.450000000000003 15 21.55 25.025 27.025 26.400000000000002 16 21.725 26.775 25.1 26.400000000000002 17 22.025 25.35 26.35 26.275 18 22.650000000000002 25.224999999999998 26.674999999999997 25.45 19 22.15 27.625 24.725 25.5 20 22.275 26.075 25.7 25.95 21 23.05 24.075 26.5 26.375 22 23.65 25.825 24.975 25.55 23 22.575 25.15 25.6 26.674999999999997 24 22.6 24.95 27.05 25.4 25 24.275 25.624999999999996 24.625 25.474999999999998 26 22.1 24.85 25.75 27.3 27 21.0 24.575 27.375 27.05 28 22.725 25.525 24.75 27.0 29 22.625 25.025 25.85 26.5 30 21.7 24.349999999999998 26.575 27.375 31 22.425 25.95 25.374999999999996 26.25 32 22.1 25.25 25.674999999999997 26.974999999999998 33 22.625 24.474999999999998 26.825 26.075 34 22.75 24.925 25.974999999999998 26.35 35 22.625 25.074999999999996 26.375 25.924999999999997 36 23.65 24.375 24.45 27.525 37 22.75 24.925 25.025 27.3 38 22.95 25.650000000000002 25.174999999999997 26.224999999999998 39 22.375 24.575 26.450000000000003 26.6 40 23.1 24.075 26.875 25.95 41 21.7 25.775 27.175 25.35 42 24.2 23.3 26.375 26.125 43 23.35 24.2 26.05 26.400000000000002 44 23.225 24.65 25.8 26.325 45 21.675 25.424999999999997 25.124999999999996 27.775 46 23.425 24.95 25.0 26.625 47 22.786393196598297 24.88744372186093 26.313156578289142 26.013006503251624 48 23.186593296648326 23.08654327163582 26.088044022011005 27.63881940970485 49 22.975 23.849999999999998 26.775 26.400000000000002 50 23.23080770192548 24.131032758189548 26.106526631657918 26.531632908227053 51 23.825 24.725 26.325 25.124999999999996 52 24.125 24.825 24.8 26.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 2.0 17 3.0 18 3.5 19 4.0 20 3.5 21 3.0 22 2.5 23 2.0 24 4.5 25 7.0 26 10.0 27 13.0 28 18.0 29 23.0 30 31.0 31 39.0 32 41.0 33 43.0 34 55.0 35 67.0 36 82.5 37 98.0 38 118.5 39 165.0 40 191.0 41 206.0 42 221.0 43 247.0 44 273.0 45 305.0 46 337.0 47 370.0 48 403.0 49 406.5 50 410.0 51 409.0 52 408.0 53 394.5 54 381.0 55 349.0 56 317.0 57 263.0 58 209.0 59 182.0 60 155.0 61 136.0 62 117.0 63 83.5 64 38.5 65 27.0 66 22.5 67 18.0 68 17.5 69 17.0 70 13.0 71 9.0 72 7.0 73 5.0 74 4.0 75 3.0 76 2.0 77 1.0 78 2.0 79 3.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.05 48 0.05 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.275 #Duplication Level Percentage of deduplicated Percentage of total 1 97.73837059881778 95.075 2 1.927525057825752 3.75 3 0.20560267283474687 0.6 4 0.07710100231303006 0.3 5 0.02570033410434336 0.125 6 0.02570033410434336 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 6 0.15 No Hit GTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174698 spots for SRR5423518.sra Written 174698 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra Read 174690 spots for SRR5423518.sra Written 174690 spots for SRR5423518.sra SRR ids: ['SRR5423518.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aimj7v7_ SRR5423518.sra spots: 3493808 blocks: [[1, 174690], [174691, 349380], [349381, 524070], [524071, 698760], [698761, 873450], [873451, 1048140], [1048141, 1222830], [1222831, 1397520], [1397521, 1572210], [1572211, 1746900], [1746901, 1921590], [1921591, 2096280], [2096281, 2270970], [2270971, 2445660], [2445661, 2620350], [2620351, 2795040], [2795041, 2969730], [2969731, 3144420], [3144421, 3319110], [3319111, 3493808]] SRR5423518 file size 614756 SRR5423518 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423518 SRR5423518_1.fastq Input file: SRR5423518_1.fastq trimmed: SRR5423518-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 16:26:52 2025 >> started Wed Feb 12 16:26:53 2025 >> done (1.519s) 3493808 reads processed; of these: 193 ( 0.01%) short reads filtered out after trimming by size control 250 ( 0.01%) empty reads filtered out after trimming by size control 3493365 (99.99%) reads available; of these: 48447 ( 1.39%) trimmed reads available after processing 3444918 (98.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 6 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 2 0.00% 27 3 0.00% 28 3 0.00% 29 1 0.00% 30 2 0.00% 31 5 0.00% 32 3 0.00% 33 10 0.00% 34 10 0.00% 35 10 0.00% 36 12 0.00% 37 14 0.00% 38 26 0.00% 39 37 0.00% 40 39 0.00% 41 50 0.00% 42 48 0.00% 43 77 0.00% 44 111 0.00% 45 182 0.01% 46 229 0.01% 47 397 0.01% 48 642 0.02% 49 1547 0.04% 50 5095 0.15% 51 39870 1.14% 52 3444918 98.61% 3493365 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=34 prefix-density=0.21 prefix-fanout=1.9 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=13.65 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=1.3 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTC Started job on | Feb 12 16:27:11 Started mapping on | Feb 12 16:27:11 Finished on | Feb 12 16:27:16 Mapping speed, Million of reads per hour | 2515.22 Number of input reads | 3493365 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3189515 Uniquely mapped reads % | 91.30% Average mapped length | 51.84 Number of splices: Total | 416332 Number of splices: Annotated (sjdb) | 411776 Number of splices: GT/AG | 409140 Number of splices: GC/AG | 6599 Number of splices: AT/AC | 217 Number of splices: Non-canonical | 376 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 234639 % of reads mapped to multiple loci | 6.72% Number of reads mapped to too many loci | 58112 % of reads mapped to too many loci | 1.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.31% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 69211 69211 69211 N_multimapping 234639 234639 234639 N_noFeature 110127 3154270 124645 N_ambiguous 38699 38 17949 UnstrandedReadsAssigned:3040689 PositiveStrandReadsAssigned:35207 NegativeStrandReadsAssigned:3046921 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423518 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423518-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,493,365 reads, 3,197,657 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52401 SRR5423518.ke.tsv 34699 SRR5423518.se.tsv 87100 total ==> SRR5423518.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 51 8.49636 Potri.005G024800.1.v4.1 1035 936 6 2.04933 Potri.004G059700.1.v4.1 961 862 5 1.85439 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 28.3275 3.18432 Potri.016G087400.1.v4.1 270 171 93 173.87 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 3 0.572932 Potri.012G127500.1.v4.1 977 878 92 33.4989 ==> SRR5423518.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 52 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR5423518 completed mapping pipeline successfully