Starting /dee2/code/volunteer_pipeline.sh SRR5423519 current disk space = 3051938975744 free memory = 1574697972 SRR5423519 SRAfilesize 1d5c561cb10f800b72f2080cf725471b SRR5423519.sra SRR5423519.sra file validated SRR5423519 is single end SRR5423519 is conventional basespace SRR5423519 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423519_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.018 34.0 31.0 34.0 30.0 34.0 2 32.0235 34.0 31.0 34.0 30.0 34.0 3 32.678 34.0 31.0 34.0 30.0 34.0 4 36.21825 37.0 37.0 37.0 35.0 37.0 5 36.20025 37.0 37.0 37.0 35.0 37.0 6 36.23025 37.0 37.0 37.0 35.0 37.0 7 36.25975 37.0 37.0 37.0 35.0 37.0 8 36.28025 37.0 37.0 37.0 35.0 37.0 9 38.1605 39.0 39.0 39.0 37.0 39.0 10 38.07975 39.0 38.0 39.0 37.0 39.0 11 37.8895 39.0 38.0 39.0 35.0 39.0 12 38.10025 39.0 39.0 39.0 37.0 39.0 13 37.9595 39.0 38.0 39.0 35.0 39.0 14 39.52875 41.0 39.0 41.0 37.0 41.0 15 39.4355 41.0 39.0 41.0 36.0 41.0 16 39.38775 41.0 39.0 41.0 36.0 41.0 17 39.42775 41.0 39.0 41.0 36.0 41.0 18 39.4325 41.0 39.0 41.0 36.0 41.0 19 39.458 41.0 39.0 41.0 37.0 41.0 20 39.41775 41.0 39.0 41.0 36.0 41.0 21 39.34075 41.0 39.0 41.0 36.0 41.0 22 39.3595 41.0 39.0 41.0 36.0 41.0 23 39.231 41.0 39.0 41.0 36.0 41.0 24 39.24875 41.0 39.0 41.0 36.0 41.0 25 39.319 41.0 39.0 41.0 36.0 41.0 26 39.187 41.0 39.0 41.0 36.0 41.0 27 39.18825 41.0 39.0 41.0 36.0 41.0 28 39.1405 41.0 39.0 41.0 36.0 41.0 29 39.078 40.0 39.0 41.0 36.0 41.0 30 39.0955 40.0 39.0 41.0 36.0 41.0 31 39.03775 40.0 39.0 41.0 36.0 41.0 32 38.9035 40.0 39.0 41.0 36.0 41.0 33 38.83425 40.0 39.0 41.0 35.0 41.0 34 38.8935 40.0 39.0 41.0 35.0 41.0 35 38.6575 40.0 38.0 41.0 35.0 41.0 36 38.65675 40.0 39.0 41.0 35.0 41.0 37 38.55 40.0 38.0 41.0 35.0 41.0 38 38.48675 40.0 38.0 41.0 35.0 41.0 39 38.433 40.0 38.0 41.0 34.0 41.0 40 38.21 40.0 38.0 41.0 34.0 41.0 41 38.135 40.0 38.0 41.0 33.0 41.0 42 38.014 40.0 38.0 41.0 33.0 41.0 43 38.03575 40.0 38.0 41.0 33.0 41.0 44 37.9165 40.0 38.0 41.0 33.0 41.0 45 37.9015 40.0 38.0 41.0 33.0 41.0 46 37.866 40.0 38.0 41.0 33.0 41.0 47 37.79075 40.0 37.0 41.0 33.0 41.0 48 37.69275 40.0 37.0 41.0 33.0 41.0 49 37.48375 40.0 37.0 41.0 32.0 41.0 50 37.4295 40.0 37.0 41.0 32.0 41.0 51 37.33275 40.0 37.0 41.0 31.0 41.0 52 35.41425 38.0 34.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 5.0 22 3.0 23 6.0 24 9.0 25 7.0 26 17.0 27 14.0 28 29.0 29 24.0 30 35.0 31 55.0 32 61.0 33 68.0 34 105.0 35 143.0 36 242.0 37 363.0 38 780.0 39 2022.0 40 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.95397712157489 12.503325352487362 5.719606278265496 34.82309124767225 2 22.25 15.1 36.175000000000004 26.474999999999998 3 19.15 21.3 27.525 32.025 4 23.925 28.925 23.849999999999998 23.3 5 23.325000000000003 32.65 24.05 19.975 6 21.025 31.65 23.1 24.224999999999998 7 16.950000000000003 21.925 40.550000000000004 20.575 8 18.65 19.55 29.9 31.900000000000002 9 18.6 19.075 33.375 28.95 10 20.375 34.699999999999996 23.45 21.475 11 25.674999999999997 24.3 20.3 29.725 12 24.224999999999998 20.3 25.424999999999997 30.049999999999997 13 20.775 25.474999999999998 28.349999999999998 25.4 14 20.424999999999997 24.45 28.95 26.174999999999997 15 20.349999999999998 24.425 27.0 28.225 16 21.349999999999998 25.650000000000002 26.275 26.724999999999998 17 22.95 24.4 26.700000000000003 25.95 18 21.65 24.05 26.650000000000002 27.650000000000002 19 23.599999999999998 25.8 25.5 25.1 20 23.175 23.65 26.3 26.875 21 21.725 24.4 26.224999999999998 27.650000000000002 22 23.200000000000003 24.3 25.324999999999996 27.175 23 22.175 25.074999999999996 25.45 27.3 24 21.425 24.575 26.125 27.875 25 23.075000000000003 25.650000000000002 24.224999999999998 27.05 26 22.025 23.9 26.3 27.775 27 21.725 24.0 26.075 28.199999999999996 28 23.275000000000002 25.174999999999997 25.900000000000002 25.650000000000002 29 21.9 24.175 26.974999999999998 26.950000000000003 30 22.55 23.375 26.775 27.3 31 21.775 24.6 27.125 26.5 32 21.85 24.9 27.500000000000004 25.75 33 22.025 25.5 26.05 26.424999999999997 34 22.3 25.05 25.224999999999998 27.425 35 23.1 24.725 25.874999999999996 26.3 36 23.925 23.825 25.900000000000002 26.35 37 24.45 23.75 23.95 27.85 38 22.975 24.55 26.200000000000003 26.275 39 21.175 24.15 25.5 29.175 40 23.05 23.849999999999998 26.924999999999997 26.174999999999997 41 22.775000000000002 24.8 26.900000000000002 25.525 42 23.042281711283465 23.642732049036777 26.09457092819615 27.220415311483613 43 23.75 23.799999999999997 25.8 26.650000000000002 44 22.5 23.75 27.6 26.150000000000002 45 23.625 23.625 25.6 27.150000000000002 46 22.5 25.224999999999998 24.875 27.400000000000002 47 24.15 23.724999999999998 26.150000000000002 25.974999999999998 48 21.3 24.025 26.224999999999998 28.449999999999996 49 23.400000000000002 25.15 24.45 27.0 50 22.775000000000002 23.525 27.075 26.625 51 21.7 23.549999999999997 26.474999999999998 28.275 52 22.45 24.099999999999998 26.400000000000002 27.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 1.5 19 2.0 20 3.0 21 4.0 22 3.0 23 2.0 24 4.5 25 7.0 26 7.5 27 8.0 28 12.5 29 17.0 30 30.0 31 43.0 32 40.5 33 38.0 34 55.5 35 73.0 36 89.0 37 105.0 38 114.5 39 146.5 40 169.0 41 208.0 42 247.0 43 270.5 44 294.0 45 317.0 46 340.0 47 357.0 48 374.0 49 385.0 50 396.0 51 387.5 52 379.0 53 365.5 54 352.0 55 343.5 56 335.0 57 283.5 58 232.0 59 195.5 60 159.0 61 135.5 62 112.0 63 82.5 64 52.0 65 51.0 66 35.5 67 20.0 68 18.5 69 17.0 70 15.0 71 13.0 72 14.5 73 16.0 74 10.5 75 5.0 76 4.0 77 3.0 78 3.5 79 4.0 80 2.5 81 1.0 82 0.5 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.0249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.075 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.49742002063984 94.475 2 1.9865841073271415 3.85 3 0.38699690402476783 1.125 4 0.07739938080495357 0.3 5 0.05159958720330237 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 5 0.125 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra Read 200000 spots for SRR5423519.sra Written 200000 spots for SRR5423519.sra SRR ids: ['SRR5423519.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1n3jqfhl SRR5423519.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423519 file size 704009 SRR5423519 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423519 SRR5423519_1.fastq Input file: SRR5423519_1.fastq trimmed: SRR5423519-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 16:55:07 2025 >> started Wed Feb 12 16:55:09 2025 >> done (1.571s) 4000000 reads processed; of these: 147 ( 0.00%) short reads filtered out after trimming by size control 88 ( 0.00%) empty reads filtered out after trimming by size control 3999765 (99.99%) reads available; of these: 65692 ( 1.64%) trimmed reads available after processing 3934073 (98.36%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 8 0.00% 21 1 0.00% 22 0 0.00% 23 3 0.00% 24 8 0.00% 25 6 0.00% 26 10 0.00% 27 19 0.00% 28 20 0.00% 29 23 0.00% 30 22 0.00% 31 32 0.00% 32 59 0.00% 33 66 0.00% 34 40 0.00% 35 55 0.00% 36 78 0.00% 37 70 0.00% 38 86 0.00% 39 106 0.00% 40 158 0.00% 41 203 0.01% 42 226 0.01% 43 245 0.01% 44 325 0.01% 45 652 0.02% 46 957 0.02% 47 1025 0.03% 48 1442 0.04% 49 3074 0.08% 50 7459 0.19% 51 49205 1.23% 52 3934073 98.36% 3999765 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.22 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=19.56 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=1.4 sequence=ACCAGAGAAATTATTATAGCTTACATCCCAGTAAAAGCATGCTGGATATCCAGAATCCACATCATGATCATAGAAAGCCCAACTAACTATAACCCAGTAGAACACAGTTTCACATAGTAAATATTGGTATTATAAACATTATGCAGCAGCCACGGTTTCTGCAGGCTTTGCGGGTTCAGCTGGTGCCTCTGCTTCCCAGAAGGCAGTCTTCTTCCCGGTCTTAGAGACGGTCTGAAGAAC Started job on | Feb 12 16:55:19 Started mapping on | Feb 12 16:55:19 Finished on | Feb 12 16:55:24 Mapping speed, Million of reads per hour | 2879.83 Number of input reads | 3999765 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3260143 Uniquely mapped reads % | 81.51% Average mapped length | 51.84 Number of splices: Total | 433825 Number of splices: Annotated (sjdb) | 429134 Number of splices: GT/AG | 426488 Number of splices: GC/AG | 6675 Number of splices: AT/AC | 194 Number of splices: Non-canonical | 468 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305747 % of reads mapped to multiple loci | 7.64% Number of reads mapped to too many loci | 407695 % of reads mapped to too many loci | 10.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 433875 433875 433875 N_multimapping 305747 305747 305747 N_noFeature 222010 3211846 238915 N_ambiguous 45032 22 13636 UnstrandedReadsAssigned:2993101 PositiveStrandReadsAssigned:48275 NegativeStrandReadsAssigned:3007592 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423519 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423519-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,765 reads, 3,425,912 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52401 SRR5423519.ke.tsv 34699 SRR5423519.se.tsv 87100 total ==> SRR5423519.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 82 13.2477 Potri.005G024800.1.v4.1 1035 936 9 2.98105 Potri.004G059700.1.v4.1 961 862 3 1.07899 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 49 5.34157 Potri.016G087400.1.v4.1 270 171 89 161.36 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 4 0.74081 Potri.012G127500.1.v4.1 977 878 41 14.4774 ==> SRR5423519.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 58 Potri.001G212900.v4.1 60 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR5423519 completed mapping pipeline successfully