Starting /dee2/code/volunteer_pipeline.sh SRR5423521 current disk space = 3092372885504 free memory = 1339205084 SRR5423521 SRAfilesize 164bbc4bbe5991bb185f1770c76e6090 SRR5423521.sra SRR5423521.sra file validated SRR5423521 is single end SRR5423521 is conventional basespace SRR5423521 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423521_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.058 33.0 31.0 34.0 30.0 34.0 2 32.1585 34.0 31.0 34.0 30.0 34.0 3 32.17675 34.0 31.0 34.0 30.0 34.0 4 35.5495 37.0 35.0 37.0 33.0 37.0 5 35.5635 37.0 35.0 37.0 33.0 37.0 6 35.64275 37.0 35.0 37.0 33.0 37.0 7 35.78775 37.0 35.0 37.0 33.0 37.0 8 35.81275 37.0 35.0 37.0 35.0 37.0 9 37.4185 39.0 37.0 39.0 35.0 39.0 10 37.308 39.0 37.0 39.0 34.0 39.0 11 37.36225 39.0 37.0 39.0 34.0 39.0 12 37.38075 39.0 37.0 39.0 34.0 39.0 13 37.40275 39.0 37.0 39.0 34.0 39.0 14 38.703 40.0 38.0 41.0 34.0 41.0 15 38.57825 40.0 38.0 41.0 34.0 41.0 16 38.61425 40.0 38.0 41.0 34.0 41.0 17 38.35725 40.0 38.0 41.0 33.0 41.0 18 38.47775 40.0 38.0 41.0 34.0 41.0 19 38.6545 40.0 38.0 41.0 34.0 41.0 20 38.681 40.0 38.0 41.0 34.0 41.0 21 38.57025 40.0 38.0 41.0 34.0 41.0 22 38.58125 40.0 38.0 41.0 34.0 41.0 23 38.5185 40.0 38.0 41.0 34.0 41.0 24 38.46075 40.0 38.0 41.0 34.0 41.0 25 38.5255 40.0 38.0 41.0 34.0 41.0 26 38.442 40.0 38.0 41.0 34.0 41.0 27 38.496 40.0 38.0 41.0 34.0 41.0 28 38.41525 40.0 38.0 41.0 34.0 41.0 29 38.31525 40.0 38.0 41.0 34.0 41.0 30 38.22925 40.0 38.0 41.0 33.0 41.0 31 38.13375 40.0 38.0 41.0 33.0 41.0 32 37.972 40.0 37.0 41.0 33.0 41.0 33 38.10675 40.0 38.0 41.0 33.0 41.0 34 38.05075 40.0 38.0 41.0 33.0 41.0 35 37.81775 40.0 37.0 41.0 32.0 41.0 36 37.89175 40.0 37.0 41.0 33.0 41.0 37 37.74775 40.0 37.0 41.0 32.0 41.0 38 37.782 40.0 37.0 41.0 32.0 41.0 39 37.833 40.0 37.0 41.0 33.0 41.0 40 37.84575 40.0 37.0 41.0 33.0 41.0 41 37.78725 40.0 37.0 41.0 32.0 41.0 42 37.7915 40.0 37.0 41.0 33.0 41.0 43 37.386 40.0 36.0 41.0 32.0 41.0 44 37.4125 40.0 37.0 41.0 31.0 41.0 45 37.42975 40.0 37.0 41.0 32.0 41.0 46 37.19975 39.0 36.0 41.0 31.0 41.0 47 37.38375 39.0 36.0 41.0 31.0 41.0 48 37.2165 39.0 36.0 41.0 31.0 41.0 49 37.078 39.0 36.0 41.0 31.0 41.0 50 37.281 39.0 36.0 41.0 31.0 41.0 51 37.08925 39.0 36.0 41.0 31.0 41.0 52 36.30175 38.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1212 1 0.0 1212 2 0.0 1212 3 0.0 1212 4 0.0 1212 5 0.0 1212 6 0.0 1212 7 0.0 1212 8 0.0 1212 9 0.0 1212 10 0.0 1212 11 0.0 1212 12 0.0 1212 13 0.0 1212 14 0.0 1212 15 0.0 1212 16 0.0 1212 17 0.0 1212 18 0.0 1212 19 0.0 1212 20 0.0 1212 21 0.0 1212 22 0.0 1212 23 0.0 1212 24 0.0 1212 25 0.0 1212 26 0.0 1212 27 0.0 1212 28 0.0 1212 29 0.0 1212 30 0.0 1212 31 0.0 1212 32 0.0 1212 33 0.0 1212 34 0.0 1212 35 0.0 1212 36 0.0 1212 37 0.0 1212 38 0.0 1212 39 0.0 1212 40 0.0 1212 41 0.0 1212 42 0.0 1212 43 0.0 1212 44 0.0 1212 45 0.0 1212 46 0.0 1212 47 0.0 1212 48 0.0 1212 49 0.0 1212 50 0.0 1212 51 0.0 1212 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 1.0 19 0.0 20 1.0 21 1.0 22 3.0 23 4.0 24 4.0 25 7.0 26 16.0 27 27.0 28 35.0 29 55.0 30 47.0 31 78.0 32 107.0 33 126.0 34 170.0 35 239.0 36 319.0 37 421.0 38 685.0 39 1645.0 40 7.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.8958958958959 13.538538538538539 5.905905905905906 34.65965965965966 2 22.175 15.7 35.4 26.724999999999998 3 18.425 21.65 26.474999999999998 33.45 4 23.95 28.000000000000004 23.549999999999997 24.5 5 23.75 33.025 23.575 19.650000000000002 6 22.15 29.925 24.175 23.75 7 16.25 22.85 41.3 19.6 8 18.425 20.275000000000002 29.549999999999997 31.75 9 18.05 21.125 31.574999999999996 29.25 10 19.025 36.725 23.974999999999998 20.275000000000002 11 25.0 24.075 21.4 29.525000000000002 12 23.025000000000002 21.6 26.150000000000002 29.225 13 20.7 25.650000000000002 28.299999999999997 25.35 14 21.4 24.45 28.025 26.125 15 21.525 23.325000000000003 27.675 27.474999999999998 16 21.775 25.75 26.674999999999997 25.8 17 22.45 23.974999999999998 27.625 25.95 18 21.4 24.05 26.625 27.925 19 21.8 25.424999999999997 26.200000000000003 26.575 20 22.225 25.4 25.974999999999998 26.400000000000002 21 22.05 23.7 27.05 27.200000000000003 22 22.675 24.85 25.124999999999996 27.35 23 22.175 24.5 25.900000000000002 27.425 24 21.15 24.325 27.175 27.35 25 22.7 24.4 26.625 26.275 26 21.9 24.95 25.275 27.875 27 20.0 24.95 26.85 28.199999999999996 28 22.775000000000002 24.0 26.5 26.724999999999998 29 22.0 23.549999999999997 25.775 28.675 30 20.95 24.95 25.5 28.599999999999998 31 22.2 26.1 25.174999999999997 26.525 32 23.225 25.374999999999996 26.5 24.9 33 23.1 22.650000000000002 27.400000000000002 26.85 34 22.175 24.6 26.6 26.625 35 21.3 23.625 27.325 27.750000000000004 36 22.175 23.849999999999998 26.025 27.950000000000003 37 22.15 24.925 25.674999999999997 27.250000000000004 38 22.85 23.95 26.724999999999998 26.474999999999998 39 22.775000000000002 22.900000000000002 26.275 28.050000000000004 40 21.65 26.075 25.4 26.875 41 22.275 25.124999999999996 25.224999999999998 27.375 42 22.125 24.224999999999998 26.174999999999997 27.474999999999998 43 24.125 24.75 25.3 25.825 44 22.475 23.9 26.575 27.05 45 22.0 24.425 25.775 27.800000000000004 46 21.175 25.224999999999998 25.775 27.825 47 24.075 23.65 26.3 25.974999999999998 48 21.45536384096024 23.905976494123532 26.18154538634659 28.457114278569644 49 23.125 25.4 24.075 27.400000000000002 50 22.375 24.349999999999998 26.1 27.175 51 21.3 24.025 27.224999999999998 27.450000000000003 52 22.425 25.3 25.1 27.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 4.0 22 3.5 23 3.0 24 4.0 25 5.0 26 5.0 27 5.0 28 15.0 29 25.0 30 25.0 31 25.0 32 43.0 33 61.0 34 62.5 35 64.0 36 79.5 37 95.0 38 108.0 39 163.0 40 205.0 41 221.0 42 237.0 43 277.5 44 318.0 45 334.0 46 350.0 47 374.0 48 398.0 49 383.0 50 368.0 51 398.0 52 428.0 53 372.5 54 317.0 55 312.0 56 307.0 57 266.0 58 225.0 59 188.0 60 151.0 61 127.0 62 103.0 63 77.0 64 49.5 65 48.0 66 38.0 67 28.0 68 22.0 69 16.0 70 12.5 71 9.0 72 12.5 73 16.0 74 12.5 75 9.0 76 6.0 77 3.0 78 1.5 79 0.0 80 1.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.875 #Duplication Level Percentage of deduplicated Percentage of total 1 96.71447196870926 92.72500000000001 2 2.451108213820078 4.7 3 0.6779661016949152 1.95 4 0.1303780964797914 0.5 5 0.02607561929595828 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra Read 200000 spots for SRR5423521.sra Written 200000 spots for SRR5423521.sra SRR ids: ['SRR5423521.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6tddyjbx SRR5423521.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423521 file size 703975 SRR5423521 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423521 SRR5423521_1.fastq Input file: SRR5423521_1.fastq trimmed: SRR5423521-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:18:45 2025 >> started Thu Feb 13 12:18:47 2025 >> done (2.186s) 4000000 reads processed; of these: 142 ( 0.00%) short reads filtered out after trimming by size control 94 ( 0.00%) empty reads filtered out after trimming by size control 3999764 (99.99%) reads available; of these: 71413 ( 1.79%) trimmed reads available after processing 3928351 (98.21%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 5 0.00% 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 3 0.00% 25 11 0.00% 26 10 0.00% 27 14 0.00% 28 20 0.00% 29 23 0.00% 30 39 0.00% 31 40 0.00% 32 85 0.00% 33 64 0.00% 34 52 0.00% 35 47 0.00% 36 69 0.00% 37 125 0.00% 38 95 0.00% 39 89 0.00% 40 170 0.00% 41 231 0.01% 42 203 0.01% 43 309 0.01% 44 381 0.01% 45 735 0.02% 46 948 0.02% 47 1132 0.03% 48 1577 0.04% 49 3153 0.08% 50 8309 0.21% 51 53460 1.34% 52 3928351 98.21% 3999764 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.22 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=27.89 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=1.1 sequence=TCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGCCGACCTTGACCCCTGTTATTTTGAGGTCATATCTAGTATTCAGAGTTTGCCTCGATTTGGTACCGCTCTCGCGGCCCGCACCGAAACAGTGCTTTACCCCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCTCTGGGTTCGAGTGGCATTTCACCCCTAACCACAACTCATCCGCTGATTCTTCAACATCAGTCGGTTCGGACCTCCACTTAGTTTCACC Started job on | Feb 13 12:19:18 Started mapping on | Feb 13 12:19:18 Finished on | Feb 13 12:19:24 Mapping speed, Million of reads per hour | 2399.86 Number of input reads | 3999764 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3260748 Uniquely mapped reads % | 81.52% Average mapped length | 51.84 Number of splices: Total | 434249 Number of splices: Annotated (sjdb) | 429408 Number of splices: GT/AG | 426909 Number of splices: GC/AG | 6658 Number of splices: AT/AC | 212 Number of splices: Non-canonical | 470 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306392 % of reads mapped to multiple loci | 7.66% Number of reads mapped to too many loci | 405966 % of reads mapped to too many loci | 10.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.66% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 432624 432624 432624 N_multimapping 306392 306392 306392 N_noFeature 222367 3212343 239420 N_ambiguous 45071 20 13714 UnstrandedReadsAssigned:2993310 PositiveStrandReadsAssigned:48385 NegativeStrandReadsAssigned:3007614 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423521 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423521-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,764 reads, 3,423,615 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,007 rounds 52401 SRR5423521.ke.tsv 34699 SRR5423521.se.tsv 87100 total ==> SRR5423521.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 85 13.775 Potri.005G024800.1.v4.1 1035 936 9 2.9903 Potri.004G059700.1.v4.1 961 862 5 1.80389 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 53.6003 5.86118 Potri.016G087400.1.v4.1 270 171 80 145.493 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.185777 Potri.012G127500.1.v4.1 977 878 39 13.8139 ==> SRR5423521.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 73 Potri.001G212900.v4.1 63 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423521 completed mapping pipeline successfully