Starting /dee2/code/volunteer_pipeline.sh SRR5423522 current disk space = 3091834851328 free memory = 1450188404 SRR5423522 SRAfilesize 512a8a9fa126e61bc1db647331387bf3 SRR5423522.sra SRR5423522.sra file validated SRR5423522 is single end SRR5423522 is conventional basespace SRR5423522 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423522_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.82725 33.0 31.0 34.0 30.0 34.0 2 32.07725 34.0 31.0 34.0 30.0 34.0 3 32.22625 34.0 31.0 34.0 30.0 34.0 4 33.68175 37.0 35.0 37.0 26.0 37.0 5 35.1115 37.0 35.0 37.0 32.0 37.0 6 35.6715 37.0 35.0 37.0 33.0 37.0 7 35.59525 37.0 35.0 37.0 33.0 37.0 8 35.81 37.0 35.0 37.0 35.0 37.0 9 37.5305 39.0 37.0 39.0 35.0 39.0 10 37.481 39.0 37.0 39.0 35.0 39.0 11 37.46825 39.0 37.0 39.0 34.0 39.0 12 37.477 39.0 37.0 39.0 35.0 39.0 13 37.52275 39.0 37.0 39.0 35.0 39.0 14 38.74725 40.0 38.0 41.0 35.0 41.0 15 38.696 40.0 38.0 41.0 34.0 41.0 16 38.71425 40.0 38.0 41.0 34.0 41.0 17 38.733 40.0 38.0 41.0 35.0 41.0 18 38.86 40.0 38.0 41.0 36.0 41.0 19 38.65825 40.0 38.0 41.0 34.0 41.0 20 38.496 40.0 38.0 41.0 34.0 41.0 21 38.53925 40.0 38.0 41.0 34.0 41.0 22 38.7385 40.0 38.0 41.0 34.0 41.0 23 38.67325 40.0 38.0 41.0 34.0 41.0 24 38.5245 40.0 38.0 41.0 34.0 41.0 25 38.74625 40.0 38.0 41.0 34.0 41.0 26 38.62825 40.0 38.0 41.0 34.0 41.0 27 38.51525 40.0 38.0 41.0 34.0 41.0 28 38.516 40.0 38.0 41.0 34.0 41.0 29 38.36275 40.0 38.0 41.0 34.0 41.0 30 38.438 40.0 38.0 41.0 34.0 41.0 31 38.5 40.0 38.0 41.0 34.0 41.0 32 38.2845 40.0 38.0 41.0 33.0 41.0 33 38.2055 40.0 38.0 41.0 34.0 41.0 34 38.00825 40.0 38.0 41.0 33.0 41.0 35 38.12325 40.0 38.0 41.0 33.0 41.0 36 38.003 40.0 37.0 41.0 33.0 41.0 37 38.09025 40.0 38.0 41.0 33.0 41.0 38 38.06 40.0 38.0 41.0 33.0 41.0 39 37.983 40.0 37.0 41.0 33.0 41.0 40 37.83675 40.0 37.0 41.0 33.0 41.0 41 37.89075 40.0 37.0 41.0 33.0 41.0 42 37.66775 40.0 37.0 41.0 32.0 41.0 43 37.718 40.0 37.0 41.0 32.0 41.0 44 37.57925 40.0 37.0 41.0 32.0 41.0 45 37.621 40.0 37.0 41.0 32.0 41.0 46 37.36475 40.0 36.0 41.0 31.0 41.0 47 37.4755 40.0 37.0 41.0 32.0 41.0 48 37.10925 39.0 36.0 41.0 31.0 41.0 49 37.28625 39.0 36.0 41.0 31.0 41.0 50 37.41525 39.0 36.0 41.0 32.0 41.0 51 37.364 39.0 36.0 41.0 32.0 41.0 52 36.29575 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1309 1 0.0 1309 2 0.0 1309 3 0.0 1309 4 0.0 1309 5 0.0 1309 6 0.0 1309 7 0.0 1309 8 0.0 1309 9 0.0 1309 10 0.0 1309 11 0.0 1309 12 0.0 1309 13 0.0 1309 14 0.0 1309 15 0.0 1309 16 0.0 1309 17 0.0 1309 18 0.0 1309 19 0.0 1309 20 0.0 1309 21 0.0 1309 22 0.0 1309 23 0.0 1309 24 0.0 1309 25 0.0 1309 26 0.0 1309 27 0.0 1309 28 0.0 1309 29 0.0 1309 30 0.0 1309 31 0.0 1309 32 0.0 1309 33 0.0 1309 34 0.0 1309 35 0.0 1309 36 0.0 1309 37 0.0 1309 38 0.0 1309 39 0.0 1309 40 0.0 1309 41 0.0 1309 42 0.0 1309 43 0.0 1309 44 0.0 1309 45 0.0 1309 46 0.0 1309 47 0.0 1309 48 0.0 1309 49 0.0 1309 50 0.0 1309 51 0.0 1309 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 1.0 18 0.0 19 2.0 20 0.0 21 3.0 22 3.0 23 0.0 24 2.0 25 5.0 26 9.0 27 28.0 28 35.0 29 51.0 30 44.0 31 69.0 32 93.0 33 125.0 34 186.0 35 215.0 36 290.0 37 465.0 38 744.0 39 1618.0 40 8.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.284105131414265 13.667083854818523 5.306633291614518 33.74217772215269 2 22.175 15.15 35.075 27.6 3 19.5 21.775 27.175 31.55 4 25.224999999999998 27.075 24.25 23.45 5 24.075 31.0 23.0 21.925 6 19.275000000000002 31.55 25.15 24.025 7 15.725 22.575 42.25 19.45 8 18.55 18.925 31.05 31.474999999999998 9 18.55 19.375 31.374999999999996 30.7 10 20.424999999999997 33.775 24.4 21.4 11 25.25 24.025 19.1 31.624999999999996 12 23.200000000000003 20.825 26.174999999999997 29.799999999999997 13 21.45 24.675 28.599999999999998 25.275 14 21.05 24.2 28.625 26.125 15 22.125 24.55 26.25 27.075 16 22.05 24.275 26.3 27.375 17 21.55 25.025 26.025 27.400000000000002 18 22.25 25.0 26.625 26.125 19 22.95 25.1 25.95 26.0 20 23.175 23.625 26.924999999999997 26.275 21 23.125 23.674999999999997 27.05 26.150000000000002 22 22.95 24.349999999999998 26.375 26.325 23 23.53088272068017 23.455863965991497 25.78144536134033 27.231807951987996 24 22.125 25.35 24.45 28.075 25 22.8 24.349999999999998 25.124999999999996 27.725 26 22.15 24.9 26.150000000000002 26.8 27 21.25 24.45 26.5 27.800000000000004 28 23.275000000000002 25.900000000000002 25.95 24.875 29 23.849999999999998 24.2 26.3 25.650000000000002 30 20.549999999999997 24.125 27.500000000000004 27.825 31 21.55 25.275 26.625 26.55 32 22.525000000000002 23.549999999999997 28.175 25.75 33 23.0 24.05 25.7 27.250000000000004 34 23.150000000000002 24.5 25.2 27.150000000000002 35 22.35 24.525 26.6 26.525 36 21.275 25.374999999999996 25.3 28.050000000000004 37 22.775000000000002 25.775 25.624999999999996 25.825 38 23.9 23.35 25.8 26.950000000000003 39 23.0 24.0 24.65 28.349999999999998 40 22.875 25.45 25.275 26.400000000000002 41 22.95 24.075 26.1 26.875 42 23.325000000000003 24.8 25.825 26.05 43 23.375 24.625 24.875 27.125 44 21.48037009252313 24.031007751937985 26.806701675418854 27.68192048012003 45 22.025 22.925 26.775 28.275 46 21.80545136284071 25.506376594148538 26.156539134783696 26.531632908227053 47 23.10577644411103 24.33108277069267 25.98149537384346 26.581645411352838 48 22.155538884721178 24.831207801950487 24.981245311327832 28.032008002000502 49 23.325000000000003 24.125 25.75 26.8 50 21.73043260815204 24.90622655663916 25.806451612903224 27.556889222305575 51 22.83070767691923 23.43085771442861 26.03150787696924 27.70692673168292 52 24.175 23.225 24.95 27.650000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 2.5 21 4.0 22 4.5 23 5.0 24 5.5 25 6.0 26 8.5 27 11.0 28 15.0 29 19.0 30 22.0 31 25.0 32 34.5 33 44.0 34 52.0 35 60.0 36 82.5 37 105.0 38 112.0 39 149.0 40 179.0 41 201.0 42 223.0 43 254.0 44 285.0 45 304.0 46 323.0 47 360.5 48 398.0 49 395.5 50 393.0 51 404.0 52 415.0 53 407.5 54 400.0 55 361.0 56 322.0 57 268.0 58 214.0 59 195.5 60 177.0 61 129.0 62 81.0 63 75.0 64 48.5 65 28.0 66 28.0 67 28.0 68 25.0 69 22.0 70 17.5 71 13.0 72 17.0 73 21.0 74 12.0 75 3.0 76 3.0 77 3.0 78 3.0 79 3.0 80 2.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.025 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.025 45 0.0 46 0.025 47 0.025 48 0.025 49 0.0 50 0.025 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.96576763485477 93.475 2 2.4896265560165975 4.8 3 0.38900414937759337 1.125 4 0.15560165975103735 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra Read 200000 spots for SRR5423522.sra Written 200000 spots for SRR5423522.sra SRR ids: ['SRR5423522.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qlgvfz0r SRR5423522.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423522 file size 703982 SRR5423522 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423522 SRR5423522_1.fastq Input file: SRR5423522_1.fastq trimmed: SRR5423522-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:36:06 2025 >> started Thu Feb 13 12:36:09 2025 >> done (2.708s) 4000000 reads processed; of these: 159 ( 0.00%) short reads filtered out after trimming by size control 83 ( 0.00%) empty reads filtered out after trimming by size control 3999758 (99.99%) reads available; of these: 64406 ( 1.61%) trimmed reads available after processing 3935352 (98.39%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 4 0.00% 20 8 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 4 0.00% 25 8 0.00% 26 10 0.00% 27 16 0.00% 28 23 0.00% 29 12 0.00% 30 28 0.00% 31 29 0.00% 32 56 0.00% 33 65 0.00% 34 53 0.00% 35 50 0.00% 36 58 0.00% 37 78 0.00% 38 86 0.00% 39 104 0.00% 40 170 0.00% 41 172 0.00% 42 193 0.00% 43 243 0.01% 44 322 0.01% 45 596 0.01% 46 900 0.02% 47 901 0.02% 48 1350 0.03% 49 2820 0.07% 50 7348 0.18% 51 48687 1.22% 52 3935352 98.39% 3999758 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.23 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=11.17 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=2.2 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCT Started job on | Feb 13 12:36:23 Started mapping on | Feb 13 12:36:23 Finished on | Feb 13 12:36:29 Mapping speed, Million of reads per hour | 2399.85 Number of input reads | 3999758 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3259693 Uniquely mapped reads % | 81.50% Average mapped length | 51.84 Number of splices: Total | 432946 Number of splices: Annotated (sjdb) | 428182 Number of splices: GT/AG | 425359 Number of splices: GC/AG | 6914 Number of splices: AT/AC | 211 Number of splices: Non-canonical | 462 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.57 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305611 % of reads mapped to multiple loci | 7.64% Number of reads mapped to too many loci | 407863 % of reads mapped to too many loci | 10.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.66% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 434454 434454 434454 N_multimapping 305611 305611 305611 N_noFeature 221362 3211640 238349 N_ambiguous 44775 20 13702 UnstrandedReadsAssigned:2993556 PositiveStrandReadsAssigned:48033 NegativeStrandReadsAssigned:3007642 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423522 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423522-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,758 reads, 3,424,775 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR5423522.ke.tsv 34699 SRR5423522.se.tsv 87100 total ==> SRR5423522.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 65 10.5345 Potri.005G024800.1.v4.1 1035 936 6 1.99366 Potri.004G059700.1.v4.1 961 862 4 1.44321 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 36.7498 4.01885 Potri.016G087400.1.v4.1 270 171 95 172.784 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 47 16.6487 ==> SRR5423522.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 51 Potri.001G212900.v4.1 56 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423522 completed mapping pipeline successfully