Starting /dee2/code/volunteer_pipeline.sh SRR5423523 current disk space = 3091165564928 free memory = 1573199408 SRR5423523 SRAfilesize 41a6f41c492ef8b5168c833d899379b5 SRR5423523.sra SRR5423523.sra file validated SRR5423523 is single end SRR5423523 is conventional basespace SRR5423523 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423523_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.551 34.0 31.0 34.0 31.0 34.0 2 32.64025 34.0 31.0 34.0 31.0 34.0 3 32.70125 34.0 31.0 34.0 31.0 34.0 4 36.122 37.0 37.0 37.0 35.0 37.0 5 36.1875 37.0 37.0 37.0 35.0 37.0 6 36.18275 37.0 37.0 37.0 35.0 37.0 7 36.113 37.0 36.0 37.0 35.0 37.0 8 36.188 37.0 36.0 37.0 35.0 37.0 9 37.963 39.0 38.0 39.0 35.0 39.0 10 37.93425 39.0 38.0 39.0 35.0 39.0 11 37.9555 39.0 38.0 39.0 35.0 39.0 12 37.9925 39.0 38.0 39.0 35.0 39.0 13 37.958 39.0 38.0 39.0 35.0 39.0 14 39.2275 40.0 39.0 41.0 36.0 41.0 15 39.23675 41.0 39.0 41.0 36.0 41.0 16 39.16075 40.0 39.0 41.0 36.0 41.0 17 39.2065 40.0 39.0 41.0 36.0 41.0 18 39.1215 40.0 39.0 41.0 36.0 41.0 19 39.12125 40.0 39.0 41.0 36.0 41.0 20 39.241 40.0 39.0 41.0 36.0 41.0 21 39.04525 40.0 39.0 41.0 36.0 41.0 22 39.152 40.0 39.0 41.0 36.0 41.0 23 39.06525 40.0 39.0 41.0 35.0 41.0 24 39.07 40.0 39.0 41.0 36.0 41.0 25 39.066 40.0 39.0 41.0 36.0 41.0 26 39.02475 40.0 39.0 41.0 35.0 41.0 27 38.93175 40.0 39.0 41.0 35.0 41.0 28 38.71525 40.0 38.0 41.0 35.0 41.0 29 38.90575 40.0 38.0 41.0 35.0 41.0 30 38.94275 40.0 39.0 41.0 35.0 41.0 31 38.985 40.0 39.0 41.0 35.0 41.0 32 38.75525 40.0 38.0 41.0 35.0 41.0 33 38.76875 40.0 38.0 41.0 35.0 41.0 34 38.79625 40.0 38.0 41.0 35.0 41.0 35 38.769 40.0 38.0 41.0 35.0 41.0 36 38.74675 40.0 38.0 41.0 35.0 41.0 37 38.65125 40.0 38.0 41.0 35.0 41.0 38 38.5775 40.0 38.0 41.0 35.0 41.0 39 38.50625 40.0 38.0 41.0 34.0 41.0 40 38.4315 40.0 38.0 41.0 34.0 41.0 41 38.451 40.0 38.0 41.0 34.0 41.0 42 38.3305 40.0 38.0 41.0 34.0 41.0 43 38.34375 40.0 38.0 41.0 34.0 41.0 44 38.30475 40.0 38.0 41.0 34.0 41.0 45 38.2765 40.0 38.0 41.0 34.0 41.0 46 38.291 40.0 38.0 41.0 34.0 41.0 47 37.65625 40.0 37.0 41.0 32.0 41.0 48 37.7135 40.0 37.0 41.0 33.0 41.0 49 37.818 40.0 37.0 41.0 33.0 41.0 50 37.8835 40.0 37.0 41.0 33.0 41.0 51 37.55225 40.0 37.0 41.0 32.0 41.0 52 36.73525 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2106 1 0.0 2106 2 0.0 2106 3 0.0 2106 4 0.0 2106 5 0.0 2106 6 0.0 2106 7 0.0 2106 8 0.0 2106 9 0.0 2106 10 0.0 2106 11 0.0 2106 12 0.0 2106 13 0.0 2106 14 0.0 2106 15 0.0 2106 16 0.0 2106 17 0.0 2106 18 0.0 2106 19 0.0 2106 20 0.0 2106 21 0.0 2106 22 0.0 2106 23 0.0 2106 24 0.0 2106 25 0.0 2106 26 0.0 2106 27 0.0 2106 28 0.0 2106 29 0.0 2106 30 0.0 2106 31 0.0 2106 32 0.0 2106 33 0.0 2106 34 0.0 2106 35 0.0 2106 36 0.0 2106 37 0.0 2106 38 0.0 2106 39 0.0 2106 40 0.0 2106 41 0.0 2106 42 0.0 2106 43 0.0 2106 44 0.0 2106 45 0.0 2106 46 0.0 2106 47 0.0 2106 48 0.0 2106 49 0.0 2106 50 0.0 2106 51 0.0 2106 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 7.0 24 6.0 25 10.0 26 8.0 27 10.0 28 16.0 29 38.0 30 36.0 31 47.0 32 52.0 33 82.0 34 114.0 35 192.0 36 231.0 37 404.0 38 724.0 39 2012.0 40 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.433007763586275 13.423491109441525 5.634861006761834 33.50864012021037 2 21.2 15.55 35.05 28.199999999999996 3 18.775 21.725 27.200000000000003 32.300000000000004 4 23.599999999999998 30.0 22.7 23.7 5 22.875 33.0 23.175 20.95 6 20.674999999999997 30.975 23.9 24.45 7 15.775 21.224999999999998 41.949999999999996 21.05 8 17.8 19.925 29.825000000000003 32.45 9 18.425 20.424999999999997 32.0 29.15 10 19.650000000000002 35.35 23.875 21.125 11 24.95 24.45 21.25 29.349999999999998 12 22.95 21.375 26.275 29.4 13 21.325 24.474999999999998 28.725 25.474999999999998 14 20.275000000000002 25.874999999999996 27.725 26.125 15 20.7 24.3 27.55 27.450000000000003 16 22.575 24.925 27.175 25.324999999999996 17 22.075 24.099999999999998 27.150000000000002 26.674999999999997 18 22.45 24.474999999999998 26.224999999999998 26.85 19 23.0 23.25 26.174999999999997 27.575 20 21.175 25.924999999999997 25.674999999999997 27.224999999999998 21 22.225 25.174999999999997 26.924999999999997 25.674999999999997 22 22.45 24.825 26.0 26.724999999999998 23 22.35 24.65 26.6 26.400000000000002 24 22.5 24.275 26.825 26.400000000000002 25 22.975 24.85 26.075 26.1 26 23.849999999999998 24.075 25.525 26.55 27 22.025 23.849999999999998 26.275 27.85 28 22.075 24.65 25.275 28.000000000000004 29 22.05 23.625 26.775 27.55 30 22.400000000000002 22.45 27.125 28.025 31 22.225 24.4 26.875 26.5 32 21.15 25.974999999999998 26.75 26.125 33 21.8 24.375 27.125 26.700000000000003 34 22.95 24.05 25.4 27.6 35 21.45 24.975 26.375 27.200000000000003 36 22.225 24.375 26.3 27.1 37 22.675 25.05 25.724999999999998 26.55 38 23.7 23.925 24.05 28.325 39 21.95 24.175 25.374999999999996 28.499999999999996 40 22.425 24.925 26.55 26.1 41 23.25 25.900000000000002 25.324999999999996 25.525 42 21.475 25.174999999999997 26.525 26.825 43 23.849999999999998 23.799999999999997 25.95 26.400000000000002 44 21.475 24.55 26.25 27.725 45 21.5 23.125 28.025 27.35 46 22.95 24.025 25.75 27.275 47 23.75 22.15 26.55 27.55 48 23.35 23.150000000000002 25.924999999999997 27.575 49 22.375 24.3 26.125 27.200000000000003 50 23.175 24.099999999999998 25.7 27.025 51 21.95 24.375 25.324999999999996 28.349999999999998 52 22.325 25.775 23.95 27.950000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 2.0 22 6.0 23 10.0 24 7.0 25 4.0 26 5.0 27 6.0 28 15.0 29 24.0 30 29.5 31 35.0 32 33.0 33 31.0 34 51.5 35 72.0 36 94.5 37 117.0 38 128.5 39 161.5 40 183.0 41 217.0 42 251.0 43 262.5 44 274.0 45 312.0 46 350.0 47 381.0 48 412.0 49 396.0 50 380.0 51 369.5 52 359.0 53 352.5 54 346.0 55 326.0 56 306.0 57 274.5 58 243.0 59 197.5 60 152.0 61 124.5 62 97.0 63 76.0 64 52.0 65 49.0 66 41.5 67 34.0 68 25.5 69 17.0 70 18.5 71 20.0 72 15.0 73 10.0 74 10.5 75 11.0 76 7.5 77 4.0 78 4.5 79 5.0 80 2.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.1 #Duplication Level Percentage of deduplicated Percentage of total 1 96.74817898022893 92.975 2 2.679500520291363 5.1499999999999995 3 0.3902185223725286 1.125 4 0.1300728407908429 0.5 5 0.052029136316337155 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 5 0.125 No Hit CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra Read 200000 spots for SRR5423523.sra Written 200000 spots for SRR5423523.sra SRR ids: ['SRR5423523.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3txsbl9r SRR5423523.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423523 file size 703995 SRR5423523 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423523 SRR5423523_1.fastq Input file: SRR5423523_1.fastq trimmed: SRR5423523-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:14:31 2025 >> started Thu Feb 13 13:14:33 2025 >> done (1.825s) 4000000 reads processed; of these: 145 ( 0.00%) short reads filtered out after trimming by size control 87 ( 0.00%) empty reads filtered out after trimming by size control 3999768 (99.99%) reads available; of these: 66806 ( 1.67%) trimmed reads available after processing 3932962 (98.33%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 5 0.00% 20 5 0.00% 21 0 0.00% 22 3 0.00% 23 2 0.00% 24 6 0.00% 25 12 0.00% 26 13 0.00% 27 19 0.00% 28 25 0.00% 29 37 0.00% 30 35 0.00% 31 53 0.00% 32 71 0.00% 33 66 0.00% 34 43 0.00% 35 51 0.00% 36 59 0.00% 37 90 0.00% 38 96 0.00% 39 99 0.00% 40 138 0.00% 41 192 0.00% 42 225 0.01% 43 304 0.01% 44 371 0.01% 45 586 0.01% 46 870 0.02% 47 1018 0.03% 48 1590 0.04% 49 3245 0.08% 50 8083 0.20% 51 49385 1.23% 52 3932962 98.33% 3999768 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.23 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=19.50 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.4 sequence=CTTCCCTCTAAGCGGAACGCTCCCCTACCGATGCATTTTTACATCCCACAGCTTCGGCAGATCGCTTAGCCCCGTTCATCTTCGGCGCAAGAGCGCTCGATCAGTGAGCTATTACGCACTCTTTCAAGGGTGGCTGCTTCTAGGCAAACCTCCTGGCTGTCTCTGCACCCCTACCTCCTTTATCACTGAGCGGTCATTTAGGGGCCTTAGCTGGTGATCCGGGCTGTTTCCCTCTCGACGATGAAGCTTATCCCCCACCGTCTCACTGGCCGACCTTGACCCCTGTTATTTTGAGGTCATATCTAGTATTCAGAGTTTGCCTCGATTTGGTACCGCTCTCGCGGCCCGCACCGAAACAGTGCTTTACCCCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCTCTGGGTTCGAGTGGCATTTCACCCCTAACCACAACTCATCCGCTGATTCTTCAACATCAGTCGGTTCGGACCTCCACTTAGTTTCA Started job on | Feb 13 13:14:46 Started mapping on | Feb 13 13:14:46 Finished on | Feb 13 13:14:51 Mapping speed, Million of reads per hour | 2879.83 Number of input reads | 3999768 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3260703 Uniquely mapped reads % | 81.52% Average mapped length | 51.83 Number of splices: Total | 432956 Number of splices: Annotated (sjdb) | 428170 Number of splices: GT/AG | 425472 Number of splices: GC/AG | 6805 Number of splices: AT/AC | 220 Number of splices: Non-canonical | 459 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.00% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305954 % of reads mapped to multiple loci | 7.65% Number of reads mapped to too many loci | 405663 % of reads mapped to too many loci | 10.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.68% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 433111 433111 433111 N_multimapping 305954 305954 305954 N_noFeature 222435 3211944 239669 N_ambiguous 45460 41 13914 UnstrandedReadsAssigned:2992808 PositiveStrandReadsAssigned:48718 NegativeStrandReadsAssigned:3007120 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423523 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423523-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,768 reads, 3,413,587 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52401 SRR5423523.ke.tsv 34699 SRR5423523.se.tsv 87100 total ==> SRR5423523.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 64 10.3934 Potri.005G024800.1.v4.1 1035 936 8 2.66359 Potri.004G059700.1.v4.1 961 862 7 2.53072 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 48.5332 5.31818 Potri.016G087400.1.v4.1 270 171 93 169.489 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.186165 Potri.012G127500.1.v4.1 977 878 41 14.5527 ==> SRR5423523.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 51 Potri.001G212900.v4.1 51 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423523 completed mapping pipeline successfully