Starting /dee2/code/volunteer_pipeline.sh SRR5423524 current disk space = 3090777006080 free memory = 1582067752 SRR5423524 SRAfilesize 273a0da5343888029dc658675dab106e SRR5423524.sra SRR5423524.sra file validated SRR5423524 is single end SRR5423524 is conventional basespace SRR5423524 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423524_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.071 34.0 33.0 34.0 31.0 34.0 2 33.1885 34.0 34.0 34.0 31.0 34.0 3 33.23175 34.0 34.0 34.0 31.0 34.0 4 36.50625 37.0 37.0 37.0 35.0 37.0 5 36.484 37.0 37.0 37.0 35.0 37.0 6 36.47675 37.0 37.0 37.0 35.0 37.0 7 36.4655 37.0 37.0 37.0 35.0 37.0 8 36.42925 37.0 37.0 37.0 35.0 37.0 9 38.301 39.0 39.0 39.0 37.0 39.0 10 38.2045 39.0 39.0 39.0 37.0 39.0 11 38.28675 39.0 39.0 39.0 37.0 39.0 12 38.30575 39.0 39.0 39.0 37.0 39.0 13 38.22475 39.0 39.0 39.0 37.0 39.0 14 39.86425 41.0 40.0 41.0 38.0 41.0 15 39.8435 41.0 40.0 41.0 38.0 41.0 16 39.773 41.0 40.0 41.0 38.0 41.0 17 39.77625 41.0 40.0 41.0 38.0 41.0 18 39.7705 41.0 40.0 41.0 38.0 41.0 19 39.77975 41.0 40.0 41.0 38.0 41.0 20 39.783 41.0 40.0 41.0 38.0 41.0 21 39.71625 41.0 40.0 41.0 38.0 41.0 22 39.66525 41.0 40.0 41.0 37.0 41.0 23 39.64775 41.0 40.0 41.0 37.0 41.0 24 39.6755 41.0 40.0 41.0 37.0 41.0 25 39.6985 41.0 40.0 41.0 38.0 41.0 26 39.6455 41.0 40.0 41.0 37.0 41.0 27 39.455 41.0 40.0 41.0 37.0 41.0 28 39.56325 41.0 40.0 41.0 37.0 41.0 29 39.502 41.0 40.0 41.0 37.0 41.0 30 39.50025 41.0 40.0 41.0 37.0 41.0 31 39.4065 41.0 40.0 41.0 37.0 41.0 32 39.43825 41.0 40.0 41.0 37.0 41.0 33 39.49225 41.0 40.0 41.0 37.0 41.0 34 39.398 41.0 40.0 41.0 37.0 41.0 35 39.366 41.0 40.0 41.0 37.0 41.0 36 39.23175 41.0 39.0 41.0 36.0 41.0 37 39.2685 41.0 39.0 41.0 36.0 41.0 38 39.107 41.0 39.0 41.0 36.0 41.0 39 39.10925 41.0 39.0 41.0 35.0 41.0 40 39.08425 41.0 39.0 41.0 35.0 41.0 41 38.85125 40.0 39.0 41.0 35.0 41.0 42 38.883 40.0 39.0 41.0 35.0 41.0 43 38.875 40.0 39.0 41.0 35.0 41.0 44 38.77175 40.0 38.0 41.0 35.0 41.0 45 38.651 40.0 38.0 41.0 35.0 41.0 46 38.62675 40.0 38.0 41.0 35.0 41.0 47 38.45475 40.0 38.0 41.0 34.0 41.0 48 38.429 40.0 38.0 41.0 34.0 41.0 49 38.41625 40.0 38.0 41.0 34.0 41.0 50 38.3435 40.0 38.0 41.0 34.0 41.0 51 38.383 40.0 38.0 41.0 34.0 41.0 52 37.11875 39.0 36.0 41.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10 0.0 2203 11 0.0 2203 12 0.0 2203 13 0.0 2203 14 0.0 2203 15 0.0 2203 16 0.0 2203 17 0.0 2203 18 0.0 2203 19 0.0 2203 20 0.0 2203 21 0.0 2203 22 0.0 2203 23 0.0 2203 24 0.0 2203 25 0.0 2203 26 0.0 2203 27 0.0 2203 28 0.0 2203 29 0.0 2203 30 0.0 2203 31 0.0 2203 32 0.0 2203 33 0.0 2203 34 0.0 2203 35 0.0 2203 36 0.0 2203 37 0.0 2203 38 0.0 2203 39 0.0 2203 40 0.0 2203 41 0.0 2203 42 0.0 2203 43 0.0 2203 44 0.0 2203 45 0.0 2203 46 0.0 2203 47 0.0 2203 48 0.0 2203 49 0.0 2203 50 0.0 2203 51 0.0 2203 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 4.0 22 3.0 23 2.0 24 6.0 25 1.0 26 10.0 27 9.0 28 12.0 29 17.0 30 27.0 31 39.0 32 40.0 33 45.0 34 61.0 35 106.0 36 156.0 37 249.0 38 580.0 39 2607.0 40 22.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.51977966950426 13.42013019529294 5.983975963945919 34.07611417125688 2 24.0 15.65 33.975 26.375 3 19.25 22.575 27.200000000000003 30.975 4 25.05 27.725 22.85 24.375 5 24.325 31.25 23.125 21.3 6 19.900000000000002 31.025000000000002 24.075 25.0 7 15.925 21.825 42.175000000000004 20.075000000000003 8 18.375 20.0 31.525 30.099999999999998 9 18.475 20.325 32.2 28.999999999999996 10 19.925 34.375 23.95 21.75 11 25.650000000000002 24.349999999999998 21.175 28.825 12 23.925 21.3 25.6 29.175 13 21.4 26.025 27.6 24.975 14 21.975 24.575 29.175 24.275 15 21.575 23.775 27.3 27.35 16 22.525000000000002 24.45 25.6 27.425 17 22.35 25.424999999999997 26.85 25.374999999999996 18 22.525000000000002 24.525 25.95 27.0 19 22.6 25.974999999999998 25.7 25.724999999999998 20 21.9 25.025 26.724999999999998 26.35 21 23.150000000000002 24.5 25.624999999999996 26.724999999999998 22 21.65 26.200000000000003 25.724999999999998 26.424999999999997 23 21.475 24.05 27.425 27.05 24 20.4 24.775 27.375 27.450000000000003 25 23.674999999999997 23.925 26.025 26.375 26 20.7 25.2 27.55 26.55 27 22.225 25.3 27.125 25.35 28 22.875 24.575 26.1 26.450000000000003 29 22.275 24.099999999999998 27.55 26.075 30 21.6 24.7 26.525 27.175 31 21.975 25.424999999999997 25.324999999999996 27.275 32 21.875 25.4 26.35 26.375 33 21.625 25.025 26.275 27.075 34 21.375 24.875 26.8 26.950000000000003 35 23.200000000000003 23.674999999999997 26.575 26.55 36 21.3 25.15 26.450000000000003 27.1 37 22.125 25.15 26.575 26.150000000000002 38 22.875 24.5 26.674999999999997 25.95 39 22.875 24.224999999999998 25.2 27.700000000000003 40 22.35 25.724999999999998 24.625 27.3 41 22.5 24.474999999999998 26.05 26.974999999999998 42 21.725 24.85 26.0 27.425 43 22.85 24.525 25.85 26.775 44 22.15 24.85 26.174999999999997 26.825 45 21.4 25.75 25.924999999999997 26.924999999999997 46 22.861430715357677 25.387693846923458 26.113056528264135 25.63781890945473 47 22.330582645661416 24.006001500375092 27.28182045511378 26.38159539884971 48 22.26113056528264 25.26263131565783 25.912956478239117 26.563281640820406 49 23.336668334167083 24.537268634317158 25.41270635317659 26.713356678339167 50 22.875 23.549999999999997 25.900000000000002 27.675 51 21.625 24.224999999999998 25.6 28.549999999999997 52 22.6 24.349999999999998 25.05 28.000000000000004 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 3.0 20 3.0 21 3.0 22 2.5 23 2.0 24 7.0 25 12.0 26 13.5 27 15.0 28 19.5 29 24.0 30 23.5 31 23.0 32 39.0 33 55.0 34 61.5 35 68.0 36 88.5 37 109.0 38 135.5 39 166.5 40 171.0 41 203.0 42 235.0 43 273.5 44 312.0 45 339.5 46 367.0 47 379.0 48 391.0 49 384.5 50 378.0 51 381.0 52 384.0 53 367.5 54 351.0 55 312.0 56 273.0 57 248.0 58 223.0 59 186.5 60 150.0 61 121.5 62 93.0 63 78.5 64 57.0 65 50.0 66 38.5 67 27.0 68 21.5 69 16.0 70 10.5 71 5.0 72 10.0 73 15.0 74 11.0 75 7.0 76 5.0 77 3.0 78 5.0 79 7.0 80 4.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.05 47 0.025 48 0.05 49 0.05 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.65 #Duplication Level Percentage of deduplicated Percentage of total 1 96.5237846314689 92.325 2 2.7966544694197593 5.35 3 0.4181913225300575 1.2 4 0.18295870360690017 0.7000000000000001 5 0.026136957658128592 0.125 6 0.052273915316257184 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTA 6 0.15 No Hit GCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAG 6 0.15 No Hit CTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra Read 200000 spots for SRR5423524.sra Written 200000 spots for SRR5423524.sra SRR ids: ['SRR5423524.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4_q2h7pq SRR5423524.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423524 file size 703959 SRR5423524 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423524 SRR5423524_1.fastq Input file: SRR5423524_1.fastq trimmed: SRR5423524-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:31:13 2025 >> started Thu Feb 13 13:31:15 2025 >> done (2.736s) 4000000 reads processed; of these: 162 ( 0.00%) short reads filtered out after trimming by size control 93 ( 0.00%) empty reads filtered out after trimming by size control 3999745 (99.99%) reads available; of these: 68608 ( 1.72%) trimmed reads available after processing 3931137 (98.28%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 5 0.00% 20 7 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 5 0.00% 25 4 0.00% 26 8 0.00% 27 8 0.00% 28 21 0.00% 29 26 0.00% 30 21 0.00% 31 37 0.00% 32 55 0.00% 33 73 0.00% 34 60 0.00% 35 49 0.00% 36 69 0.00% 37 111 0.00% 38 115 0.00% 39 129 0.00% 40 178 0.00% 41 253 0.01% 42 243 0.01% 43 323 0.01% 44 430 0.01% 45 773 0.02% 46 1083 0.03% 47 1153 0.03% 48 1738 0.04% 49 3206 0.08% 50 8033 0.20% 51 50381 1.26% 52 3931137 98.28% 3999745 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.21 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=12.08 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=1.9 sequence=CGCCCCGGGTTTTGCAGCGACCGCCGCGCCCTCCTACTCATCGGGGCCTGGCGCTTGCCCCGACGGCCGGGTATAGGTCGCGCGCTTCAGCGCCATCCATTTTCGGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTTCGACTTCCATGACCACCGTCCTGCTGTCTTAATCGACCAACACCCTTTGTGGGTTCTAGGTTAGCGCGCAGTTGGGCACCGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACTTGGAGCTCTCGATTCCGTGG Started job on | Feb 13 13:31:28 Started mapping on | Feb 13 13:31:29 Finished on | Feb 13 13:31:37 Mapping speed, Million of reads per hour | 1799.89 Number of input reads | 3999745 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3263992 Uniquely mapped reads % | 81.61% Average mapped length | 51.84 Number of splices: Total | 435600 Number of splices: Annotated (sjdb) | 430744 Number of splices: GT/AG | 428300 Number of splices: GC/AG | 6718 Number of splices: AT/AC | 199 Number of splices: Non-canonical | 383 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.00% Deletion average length | 1.54 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304898 % of reads mapped to multiple loci | 7.62% Number of reads mapped to too many loci | 403763 % of reads mapped to too many loci | 10.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.67% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 430855 430855 430855 N_multimapping 304898 304898 304898 N_noFeature 221222 3216282 237865 N_ambiguous 44807 27 13725 UnstrandedReadsAssigned:2997963 PositiveStrandReadsAssigned:47683 NegativeStrandReadsAssigned:3012402 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423524 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423524-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,745 reads, 3,424,012 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52401 SRR5423524.ke.tsv 34699 SRR5423524.se.tsv 87100 total ==> SRR5423524.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 72 11.6744 Potri.005G024800.1.v4.1 1035 936 9 2.99188 Potri.004G059700.1.v4.1 961 862 2 0.721939 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 42.6807 4.6696 Potri.016G087400.1.v4.1 270 171 97 176.504 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.185876 Potri.012G127500.1.v4.1 977 878 41 14.5301 ==> SRR5423524.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 59 Potri.001G212900.v4.1 58 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423524 completed mapping pipeline successfully