Starting /dee2/code/volunteer_pipeline.sh SRR5423525 current disk space = 3091229167616 free memory = 1582211000 SRR5423525 SRAfilesize 1f9b0a891bf3b780cbe64318b78b6339 SRR5423525.sra SRR5423525.sra file validated SRR5423525 is single end SRR5423525 is conventional basespace SRR5423525 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423525_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.809 31.0 30.0 34.0 27.0 34.0 2 31.4055 31.0 31.0 34.0 28.0 34.0 3 31.51125 31.0 31.0 34.0 28.0 34.0 4 31.70475 35.0 30.0 37.0 19.0 37.0 5 33.5075 35.0 33.0 37.0 28.0 37.0 6 34.6775 35.0 35.0 37.0 32.0 37.0 7 35.08525 35.0 35.0 37.0 32.0 37.0 8 35.24625 37.0 35.0 37.0 32.0 37.0 9 36.97225 39.0 37.0 39.0 33.0 39.0 10 36.818 39.0 37.0 39.0 33.0 39.0 11 36.9825 39.0 37.0 39.0 33.0 39.0 12 36.80225 39.0 37.0 39.0 32.0 39.0 13 36.94975 39.0 37.0 39.0 33.0 39.0 14 37.99375 40.0 37.0 41.0 33.0 41.0 15 38.1025 40.0 37.0 41.0 33.0 41.0 16 38.061 40.0 37.0 41.0 33.0 41.0 17 37.93725 40.0 37.0 41.0 33.0 41.0 18 38.03325 40.0 37.0 41.0 33.0 41.0 19 37.992 40.0 37.0 41.0 33.0 41.0 20 37.93275 40.0 37.0 41.0 33.0 41.0 21 37.98625 40.0 37.0 41.0 33.0 41.0 22 38.01975 40.0 37.0 41.0 33.0 41.0 23 38.05225 40.0 37.0 41.0 33.0 41.0 24 38.05525 40.0 37.0 41.0 33.0 41.0 25 38.013 40.0 37.0 41.0 33.0 41.0 26 37.79525 40.0 37.0 41.0 32.0 41.0 27 37.8175 40.0 37.0 41.0 32.0 41.0 28 37.732 40.0 37.0 41.0 32.0 41.0 29 37.60325 40.0 37.0 41.0 32.0 41.0 30 37.56025 40.0 37.0 41.0 32.0 41.0 31 37.59775 40.0 37.0 41.0 32.0 41.0 32 37.6785 40.0 37.0 41.0 33.0 41.0 33 37.61675 40.0 37.0 41.0 32.0 41.0 34 37.27575 39.0 36.0 41.0 31.0 41.0 35 37.44375 40.0 37.0 41.0 31.0 41.0 36 37.5365 40.0 37.0 41.0 32.0 41.0 37 37.5995 40.0 37.0 41.0 32.0 41.0 38 37.399 39.0 36.0 41.0 31.0 41.0 39 37.36375 39.0 36.0 41.0 31.0 41.0 40 37.374 39.0 37.0 41.0 31.0 41.0 41 37.41725 39.0 36.0 41.0 31.0 41.0 42 37.147 39.0 36.0 41.0 31.0 41.0 43 36.95425 39.0 36.0 40.0 30.0 41.0 44 36.88525 39.0 36.0 40.0 30.0 41.0 45 36.76225 39.0 35.0 40.0 30.0 41.0 46 36.95175 39.0 35.0 40.0 30.0 41.0 47 37.0315 39.0 35.0 40.0 31.0 41.0 48 36.881 39.0 35.0 40.0 31.0 41.0 49 36.799 39.0 35.0 40.0 30.0 41.0 50 36.828 39.0 35.0 40.0 31.0 41.0 51 36.64275 39.0 35.0 40.0 31.0 41.0 52 36.15075 38.0 34.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2216 1 0.0 2216 2 0.0 2216 3 0.0 2216 4 0.0 2216 5 0.0 2216 6 0.0 2216 7 0.0 2216 8 0.0 2216 9 0.0 2216 10 0.0 2216 11 0.0 2216 12 0.0 2216 13 0.0 2216 14 0.0 2216 15 0.0 2216 16 0.0 2216 17 0.0 2216 18 0.0 2216 19 0.0 2216 20 0.0 2216 21 0.0 2216 22 0.0 2216 23 0.0 2216 24 0.0 2216 25 0.0 2216 26 0.0 2216 27 0.0 2216 28 0.0 2216 29 0.0 2216 30 0.0 2216 31 0.0 2216 32 0.0 2216 33 0.0 2216 34 0.0 2216 35 0.0 2216 36 0.0 2216 37 0.0 2216 38 0.0 2216 39 0.0 2216 40 0.0 2216 41 0.0 2216 42 0.0 2216 43 0.0 2216 44 0.0 2216 45 0.0 2216 46 0.0 2216 47 0.0 2216 48 0.0 2216 49 0.0 2216 50 0.0 2216 51 0.0 2216 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 6.0 23 5.0 24 5.0 25 6.0 26 23.0 27 25.0 28 53.0 29 60.0 30 81.0 31 110.0 32 133.0 33 165.0 34 232.0 35 261.0 36 398.0 37 559.0 38 808.0 39 1066.0 40 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.73430072554416 14.085564173129846 6.554916187140355 33.62521891418564 2 22.925 16.05 34.625 26.400000000000002 3 18.85 23.825 25.1 32.225 4 26.275 26.924999999999997 24.775 22.025 5 22.425 32.275 24.425 20.875 6 19.400000000000002 31.674999999999997 25.05 23.875 7 15.65 22.325 41.25 20.775 8 17.299999999999997 20.9 30.175 31.624999999999996 9 18.925 19.650000000000002 31.85 29.575000000000003 10 19.8 35.175 23.799999999999997 21.224999999999998 11 25.074999999999996 24.6 20.525 29.799999999999997 12 23.549999999999997 20.65 25.025 30.775000000000002 13 20.25 25.974999999999998 28.299999999999997 25.474999999999998 14 21.099999999999998 25.1 27.750000000000004 26.05 15 21.825 23.875 27.325 26.974999999999998 16 23.200000000000003 24.5 25.825 26.474999999999998 17 22.35 25.324999999999996 25.825 26.5 18 22.8 23.5 25.85 27.85 19 22.125 26.775 25.924999999999997 25.174999999999997 20 21.65 25.2 27.075 26.075 21 22.075 24.9 25.95 27.075 22 22.1 26.75 26.275 24.875 23 21.175 24.875 27.325 26.625 24 22.05 24.15 25.924999999999997 27.875 25 22.25 24.45 26.950000000000003 26.35 26 21.6 24.474999999999998 27.450000000000003 26.474999999999998 27 21.675 25.3 25.525 27.500000000000004 28 22.575 25.575 25.55 26.3 29 22.35 23.674999999999997 26.775 27.200000000000003 30 20.375 24.4 26.325 28.9 31 22.275 24.575 26.174999999999997 26.974999999999998 32 21.925 25.900000000000002 26.674999999999997 25.5 33 22.425 24.7 25.95 26.924999999999997 34 23.974999999999998 24.05 27.05 24.925 35 22.3 23.95 26.325 27.425 36 23.325000000000003 24.675 25.025 26.974999999999998 37 21.5 25.025 25.650000000000002 27.825 38 22.275 24.425 26.5 26.8 39 22.6 23.9 25.5 28.000000000000004 40 22.625 25.674999999999997 24.975 26.724999999999998 41 22.225 24.2 27.075 26.5 42 22.075 25.525 25.575 26.825 43 23.125 24.224999999999998 27.474999999999998 25.174999999999997 44 23.325000000000003 24.425 25.775 26.474999999999998 45 22.900000000000002 24.224999999999998 25.95 26.924999999999997 46 22.525000000000002 24.45 25.825 27.200000000000003 47 21.349999999999998 24.7 27.450000000000003 26.5 48 22.225 24.05 25.674999999999997 28.050000000000004 49 23.925 24.825 24.525 26.724999999999998 50 22.675 23.825 25.95 27.55 51 22.55 23.775 25.275 28.4 52 22.275 24.15 27.05 26.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 3.0 23 5.0 24 7.0 25 9.0 26 10.5 27 12.0 28 13.5 29 15.0 30 30.5 31 46.0 32 48.5 33 51.0 34 57.5 35 64.0 36 86.0 37 108.0 38 116.5 39 157.5 40 190.0 41 217.0 42 244.0 43 276.5 44 309.0 45 336.5 46 364.0 47 381.0 48 398.0 49 393.5 50 389.0 51 385.0 52 381.0 53 362.0 54 343.0 55 313.5 56 284.0 57 261.0 58 238.0 59 184.5 60 131.0 61 117.5 62 104.0 63 80.0 64 49.5 65 43.0 66 36.0 67 29.0 68 26.0 69 23.0 70 15.5 71 8.0 72 9.5 73 11.0 74 8.5 75 6.0 76 5.5 77 5.0 78 5.0 79 5.0 80 3.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.975 #Duplication Level Percentage of deduplicated Percentage of total 1 97.4220159835009 94.475 2 2.165506573859242 4.2 3 0.28357824181490077 0.8250000000000001 4 0.1288992008249549 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra Read 200000 spots for SRR5423525.sra Written 200000 spots for SRR5423525.sra SRR ids: ['SRR5423525.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fl5fp2j6 SRR5423525.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423525 file size 703959 SRR5423525 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423525 SRR5423525_1.fastq Input file: SRR5423525_1.fastq trimmed: SRR5423525-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:08:34 2025 >> started Thu Feb 13 13:08:36 2025 >> done (1.928s) 4000000 reads processed; of these: 130 ( 0.00%) short reads filtered out after trimming by size control 65 ( 0.00%) empty reads filtered out after trimming by size control 3999805 (100.00%) reads available; of these: 71777 ( 1.79%) trimmed reads available after processing 3928028 (98.21%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 5 0.00% 20 6 0.00% 21 0 0.00% 22 3 0.00% 23 5 0.00% 24 1 0.00% 25 12 0.00% 26 14 0.00% 27 8 0.00% 28 36 0.00% 29 39 0.00% 30 33 0.00% 31 43 0.00% 32 79 0.00% 33 70 0.00% 34 64 0.00% 35 56 0.00% 36 79 0.00% 37 112 0.00% 38 124 0.00% 39 133 0.00% 40 211 0.01% 41 253 0.01% 42 250 0.01% 43 326 0.01% 44 477 0.01% 45 816 0.02% 46 1193 0.03% 47 1364 0.03% 48 1877 0.05% 49 3702 0.09% 50 8644 0.22% 51 51732 1.29% 52 3928028 98.21% 3999805 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=31 prefix-density=0.21 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=17.59 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.4 sequence=CGCCCCGGGTTTTGCAGCGACCGCCGCGCCCTCCTACTCATCGGGGCCTGGCGCTTGCCCCGACGGCCGGGTATAGGTCGCGCGCTTCAGCGCCATCCATTTTCGGGGCTAGTTGATTCGGCAGGTGAGTTGTTACACACTCCTTAGCGGATTTCGACTTCCATGACCACCGTCCTGCTGTCTTAATCGACCAACACCCTTTGTGGGTTCTAGGTTAGCGCGCAGTTGGGCACCGTAACCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCACTTGGAGCTCTCGATTCCGTGG Started job on | Feb 13 13:08:50 Started mapping on | Feb 13 13:08:50 Finished on | Feb 13 13:08:56 Mapping speed, Million of reads per hour | 2399.88 Number of input reads | 3999805 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3263212 Uniquely mapped reads % | 81.58% Average mapped length | 51.84 Number of splices: Total | 434768 Number of splices: Annotated (sjdb) | 430106 Number of splices: GT/AG | 427312 Number of splices: GC/AG | 6804 Number of splices: AT/AC | 221 Number of splices: Non-canonical | 431 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306159 % of reads mapped to multiple loci | 7.65% Number of reads mapped to too many loci | 402469 % of reads mapped to too many loci | 10.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.70% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 430434 430434 430434 N_multimapping 306159 306159 306159 N_noFeature 220489 3214971 237567 N_ambiguous 45131 36 13953 UnstrandedReadsAssigned:2997592 PositiveStrandReadsAssigned:48205 NegativeStrandReadsAssigned:3011692 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423525 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423525-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,805 reads, 3,417,733 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR5423525.ke.tsv 34699 SRR5423525.se.tsv 87100 total ==> SRR5423525.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 86 13.9788 Potri.005G024800.1.v4.1 1035 936 12.0184 4.00514 Potri.004G059700.1.v4.1 961 862 7 2.533 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 44.8937 4.9238 Potri.016G087400.1.v4.1 270 171 100 182.41 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 40 14.2105 ==> SRR5423525.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 55 Potri.001G212900.v4.1 53 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423525 completed mapping pipeline successfully