Starting /dee2/code/volunteer_pipeline.sh SRR5423526 current disk space = 3091604172800 free memory = 1430420676 SRR5423526 SRAfilesize 165274d69a12c0437b41675fa09af05e SRR5423526.sra SRR5423526.sra file validated SRR5423526 is single end SRR5423526 is conventional basespace SRR5423526 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423526_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.63225 31.0 31.0 34.0 30.0 34.0 2 31.973 33.0 31.0 34.0 30.0 34.0 3 32.00975 33.0 31.0 34.0 30.0 34.0 4 33.415 37.0 33.0 37.0 25.0 37.0 5 34.8905 37.0 35.0 37.0 32.0 37.0 6 35.17 37.0 35.0 37.0 32.0 37.0 7 35.41325 37.0 35.0 37.0 33.0 37.0 8 35.54575 37.0 35.0 37.0 33.0 37.0 9 37.12725 39.0 37.0 39.0 33.0 39.0 10 37.07925 39.0 37.0 39.0 33.0 39.0 11 37.2865 39.0 37.0 39.0 34.0 39.0 12 37.15625 39.0 37.0 39.0 33.0 39.0 13 37.157 39.0 37.0 39.0 33.0 39.0 14 38.44375 40.0 38.0 41.0 34.0 41.0 15 38.35225 40.0 38.0 41.0 33.0 41.0 16 38.408 40.0 38.0 41.0 34.0 41.0 17 38.3655 40.0 38.0 41.0 33.0 41.0 18 38.322 40.0 38.0 41.0 33.0 41.0 19 38.29975 40.0 38.0 41.0 34.0 41.0 20 38.22875 40.0 38.0 41.0 33.0 41.0 21 38.1025 40.0 38.0 41.0 33.0 41.0 22 38.31425 40.0 38.0 41.0 34.0 41.0 23 38.354 40.0 38.0 41.0 34.0 41.0 24 38.26625 40.0 38.0 41.0 33.0 41.0 25 38.323 40.0 38.0 41.0 34.0 41.0 26 38.19675 40.0 38.0 41.0 33.0 41.0 27 38.17675 40.0 38.0 41.0 33.0 41.0 28 38.01875 40.0 37.0 41.0 33.0 41.0 29 38.15775 40.0 38.0 41.0 33.0 41.0 30 38.143 40.0 37.0 41.0 33.0 41.0 31 38.117 40.0 38.0 41.0 33.0 41.0 32 38.1215 40.0 38.0 41.0 33.0 41.0 33 38.20325 40.0 38.0 41.0 34.0 41.0 34 38.1285 40.0 38.0 41.0 33.0 41.0 35 38.0315 40.0 37.0 41.0 33.0 41.0 36 37.75975 40.0 37.0 41.0 32.0 41.0 37 37.97425 40.0 37.0 41.0 33.0 41.0 38 37.72625 40.0 37.0 41.0 33.0 41.0 39 37.386 40.0 37.0 41.0 31.0 41.0 40 37.26475 39.0 36.0 41.0 31.0 41.0 41 37.08425 39.0 36.0 41.0 31.0 41.0 42 37.35875 39.0 36.0 41.0 31.0 41.0 43 37.4425 39.0 36.0 41.0 32.0 41.0 44 37.42525 39.0 36.0 41.0 32.0 41.0 45 37.1945 39.0 36.0 41.0 31.0 41.0 46 37.2515 39.0 36.0 41.0 31.0 41.0 47 37.122 39.0 36.0 41.0 31.0 41.0 48 36.899 39.0 36.0 41.0 30.0 41.0 49 36.85425 39.0 35.0 41.0 30.0 41.0 50 36.8585 39.0 35.0 41.0 30.0 41.0 51 36.6755 39.0 35.0 40.0 30.0 41.0 52 36.0265 38.0 35.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2313 1 0.0 2313 2 0.0 2313 3 0.0 2313 4 0.0 2313 5 0.0 2313 6 0.0 2313 7 0.0 2313 8 0.0 2313 9 0.0 2313 10 0.0 2313 11 0.0 2313 12 0.0 2313 13 0.0 2313 14 0.0 2313 15 0.0 2313 16 0.0 2313 17 0.0 2313 18 0.0 2313 19 0.0 2313 20 0.0 2313 21 0.0 2313 22 0.0 2313 23 0.0 2313 24 0.0 2313 25 0.0 2313 26 0.0 2313 27 0.0 2313 28 0.0 2313 29 0.0 2313 30 0.0 2313 31 0.0 2313 32 0.0 2313 33 0.0 2313 34 0.0 2313 35 0.0 2313 36 0.0 2313 37 0.0 2313 38 0.0 2313 39 0.0 2313 40 0.0 2313 41 0.0 2313 42 0.0 2313 43 0.0 2313 44 0.0 2313 45 0.0 2313 46 0.0 2313 47 0.0 2313 48 0.0 2313 49 0.0 2313 50 0.0 2313 51 0.0 2313 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 4.0 23 5.0 24 5.0 25 10.0 26 20.0 27 29.0 28 30.0 29 54.0 30 62.0 31 88.0 32 101.0 33 159.0 34 220.0 35 237.0 36 335.0 37 497.0 38 774.0 39 1365.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.725 12.775 5.25 35.25 2 22.6 16.0 33.425 27.975 3 19.45 21.2 27.675 31.674999999999997 4 23.325000000000003 28.4 24.3 23.974999999999998 5 24.025 32.574999999999996 22.575 20.825 6 19.675 32.9 23.625 23.799999999999997 7 15.6 21.175 41.775 21.45 8 18.5 19.875 31.900000000000002 29.725 9 18.7 20.25 31.974999999999998 29.075 10 20.25 34.775 22.95 22.025 11 25.85 24.65 19.55 29.95 12 24.275 21.3 25.900000000000002 28.525 13 20.724999999999998 24.8 28.7 25.775 14 21.575 24.474999999999998 27.325 26.625 15 21.625 24.75 26.575 27.05 16 22.8 24.725 26.05 26.424999999999997 17 21.525 25.424999999999997 26.174999999999997 26.875 18 23.1 24.0 25.974999999999998 26.924999999999997 19 22.45 25.35 25.974999999999998 26.224999999999998 20 21.85 25.2 27.05 25.900000000000002 21 21.425 24.3 27.900000000000002 26.375 22 22.400000000000002 23.724999999999998 27.900000000000002 25.974999999999998 23 23.125 24.9 24.675 27.3 24 22.025 24.5 26.825 26.650000000000002 25 21.8 24.85 26.0 27.35 26 23.025000000000002 23.974999999999998 25.674999999999997 27.325 27 21.099999999999998 25.0 26.200000000000003 27.700000000000003 28 22.375 24.65 26.700000000000003 26.275 29 22.425 25.025 26.575 25.974999999999998 30 22.025 24.224999999999998 25.624999999999996 28.125 31 21.625 24.8 26.400000000000002 27.175 32 22.1 24.325 26.575 27.0 33 23.3 24.075 26.400000000000002 26.224999999999998 34 22.2 24.875 26.575 26.35 35 22.3 24.85 26.05 26.8 36 22.35 24.9 24.925 27.825 37 21.45 25.624999999999996 24.875 28.050000000000004 38 22.75 25.05 26.275 25.924999999999997 39 23.45 23.625 25.974999999999998 26.950000000000003 40 23.7 24.5 25.05 26.75 41 22.125 25.05 25.674999999999997 27.150000000000002 42 21.675 24.675 26.825 26.825 43 23.525 23.875 26.375 26.224999999999998 44 24.25 24.675 24.4 26.674999999999997 45 23.075000000000003 25.074999999999996 25.974999999999998 25.874999999999996 46 23.305826456614152 24.831207801950487 25.70642660665166 26.156539134783696 47 23.78094523630908 24.706176544136035 24.756189047261813 26.756689172293076 48 22.55563890972743 24.456114028507127 25.30632658164541 27.68192048012003 49 22.925 25.45 24.75 26.875 50 22.305576394098527 25.456364091022753 25.656414103525883 26.581645411352838 51 22.425 23.474999999999998 25.7 28.4 52 22.25 24.474999999999998 25.650000000000002 27.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 3.0 21 5.0 22 4.5 23 4.0 24 5.5 25 7.0 26 9.0 27 11.0 28 17.0 29 23.0 30 27.5 31 32.0 32 40.0 33 48.0 34 54.5 35 61.0 36 92.5 37 124.0 38 117.5 39 136.5 40 162.0 41 208.0 42 254.0 43 278.0 44 302.0 45 326.5 46 351.0 47 364.0 48 377.0 49 379.0 50 381.0 51 382.5 52 384.0 53 387.5 54 391.0 55 334.0 56 277.0 57 253.0 58 229.0 59 194.5 60 160.0 61 132.0 62 104.0 63 80.0 64 52.5 65 49.0 66 42.0 67 35.0 68 25.0 69 15.0 70 17.0 71 19.0 72 14.5 73 10.0 74 9.5 75 9.0 76 6.5 77 4.0 78 3.0 79 2.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.025 48 0.025 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.6 #Duplication Level Percentage of deduplicated Percentage of total 1 96.39121338912135 92.15 2 2.8504184100418413 5.45 3 0.6014644351464435 1.725 4 0.10460251046025104 0.4 5 0.02615062761506276 0.125 6 0.02615062761506276 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGC 6 0.15 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52558 spots for SRR5423526.sra Written 52558 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra Read 52546 spots for SRR5423526.sra Written 52546 spots for SRR5423526.sra SRR ids: ['SRR5423526.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x5628bm1 SRR5423526.sra spots: 1050932 blocks: [[1, 52546], [52547, 105092], [105093, 157638], [157639, 210184], [210185, 262730], [262731, 315276], [315277, 367822], [367823, 420368], [420369, 472914], [472915, 525460], [525461, 578006], [578007, 630552], [630553, 683098], [683099, 735644], [735645, 788190], [788191, 840736], [840737, 893282], [893283, 945828], [945829, 998374], [998375, 1050932]] SRR5423526 file size 184162 SRR5423526 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423526 SRR5423526_1.fastq Input file: SRR5423526_1.fastq trimmed: SRR5423526-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:47:20 2025 >> started Thu Feb 13 12:47:21 2025 >> done (0.646s) 1050932 reads processed; of these: 32 ( 0.00%) short reads filtered out after trimming by size control 18 ( 0.00%) empty reads filtered out after trimming by size control 1050882 (100.00%) reads available; of these: 16473 ( 1.57%) trimmed reads available after processing 1034409 (98.43%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 4 0.00% 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 3 0.00% 30 1 0.00% 31 2 0.00% 32 2 0.00% 33 6 0.00% 34 3 0.00% 35 3 0.00% 36 4 0.00% 37 4 0.00% 38 12 0.00% 39 13 0.00% 40 13 0.00% 41 16 0.00% 42 29 0.00% 43 22 0.00% 44 27 0.00% 45 44 0.00% 46 78 0.01% 47 129 0.01% 48 211 0.02% 49 556 0.05% 50 1837 0.17% 51 13449 1.28% 52 1034409 98.43% 1050882 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=21 prefix-density=0.22 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=11.89 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=2.2 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCT Started job on | Feb 13 12:47:31 Started mapping on | Feb 13 12:47:31 Finished on | Feb 13 12:47:36 Mapping speed, Million of reads per hour | 756.64 Number of input reads | 1050882 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 856820 Uniquely mapped reads % | 81.53% Average mapped length | 51.83 Number of splices: Total | 113526 Number of splices: Annotated (sjdb) | 112318 Number of splices: GT/AG | 111640 Number of splices: GC/AG | 1734 Number of splices: AT/AC | 47 Number of splices: Non-canonical | 105 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.00% Deletion average length | 1.54 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 80491 % of reads mapped to multiple loci | 7.66% Number of reads mapped to too many loci | 106675 % of reads mapped to too many loci | 10.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 113571 113571 113571 N_multimapping 80491 80491 80491 N_noFeature 59143 844212 63666 N_ambiguous 11775 6 3691 UnstrandedReadsAssigned:785902 PositiveStrandReadsAssigned:12602 NegativeStrandReadsAssigned:789463 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423526 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423526-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 1,050,882 reads, 896,620 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 995 rounds 52401 SRR5423526.ke.tsv 34699 SRR5423526.se.tsv 87100 total ==> SRR5423526.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 32 19.684 Potri.005G024800.1.v4.1 1035 936 2 2.52228 Potri.004G059700.1.v4.1 961 862 2 2.73881 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 12.2832 5.09826 Potri.016G087400.1.v4.1 270 171 28 193.286 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 11 14.7889 ==> SRR5423526.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 11 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423526 completed mapping pipeline successfully