Starting /dee2/code/volunteer_pipeline.sh SRR5423527 current disk space = 3092111364096 free memory = 1326261664 SRR5423527 SRAfilesize 2d0c4b124261cd03773074a0729fdf73 SRR5423527.sra SRR5423527.sra file validated SRR5423527 is single end SRR5423527 is conventional basespace SRR5423527 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423527_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.77775 34.0 31.0 34.0 30.0 34.0 2 31.82925 34.0 31.0 34.0 28.0 34.0 3 32.57425 34.0 31.0 34.0 30.0 34.0 4 36.105 37.0 35.0 37.0 35.0 37.0 5 36.15425 37.0 35.0 37.0 35.0 37.0 6 36.19575 37.0 37.0 37.0 35.0 37.0 7 36.192 37.0 37.0 37.0 35.0 37.0 8 36.2295 37.0 37.0 37.0 35.0 37.0 9 38.1075 39.0 39.0 39.0 37.0 39.0 10 37.95425 39.0 38.0 39.0 35.0 39.0 11 37.90925 39.0 38.0 39.0 35.0 39.0 12 37.99625 39.0 38.0 39.0 35.0 39.0 13 37.91925 39.0 38.0 39.0 35.0 39.0 14 39.40325 41.0 39.0 41.0 37.0 41.0 15 39.4 41.0 39.0 41.0 36.0 41.0 16 39.29925 41.0 39.0 41.0 36.0 41.0 17 39.41825 41.0 39.0 41.0 36.0 41.0 18 39.32725 41.0 39.0 41.0 36.0 41.0 19 39.329 41.0 39.0 41.0 36.0 41.0 20 39.3435 41.0 39.0 41.0 37.0 41.0 21 39.17275 40.0 39.0 41.0 36.0 41.0 22 39.1795 40.0 39.0 41.0 36.0 41.0 23 39.1545 40.0 39.0 41.0 36.0 41.0 24 39.0755 40.0 39.0 41.0 36.0 41.0 25 39.0885 40.0 39.0 41.0 36.0 41.0 26 38.99975 40.0 39.0 41.0 36.0 41.0 27 38.9055 40.0 39.0 41.0 35.0 41.0 28 38.947 40.0 39.0 41.0 35.0 41.0 29 38.918 40.0 39.0 41.0 36.0 41.0 30 38.8205 40.0 39.0 41.0 35.0 41.0 31 38.81475 40.0 39.0 41.0 35.0 41.0 32 38.723 40.0 39.0 41.0 35.0 41.0 33 38.692 40.0 38.0 41.0 35.0 41.0 34 38.681 40.0 38.0 41.0 35.0 41.0 35 38.619 40.0 38.0 41.0 35.0 41.0 36 38.56125 40.0 38.0 41.0 34.0 41.0 37 38.41125 40.0 38.0 41.0 34.0 41.0 38 38.32725 40.0 38.0 41.0 34.0 41.0 39 38.22575 40.0 38.0 41.0 33.0 41.0 40 38.084 40.0 38.0 41.0 33.0 41.0 41 37.91525 40.0 38.0 41.0 33.0 41.0 42 37.757 40.0 38.0 41.0 33.0 41.0 43 37.80575 40.0 38.0 41.0 33.0 41.0 44 37.689 40.0 38.0 41.0 33.0 41.0 45 37.702 40.0 37.0 41.0 32.0 41.0 46 37.55525 40.0 37.0 41.0 32.0 41.0 47 37.51975 40.0 37.0 41.0 31.0 41.0 48 37.30775 40.0 37.0 41.0 31.0 41.0 49 37.3365 40.0 37.0 41.0 31.0 41.0 50 37.28075 40.0 36.0 41.0 31.0 41.0 51 37.0535 40.0 36.0 41.0 30.0 41.0 52 35.00775 38.0 34.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 2.0 20 3.0 21 6.0 22 3.0 23 8.0 24 6.0 25 6.0 26 14.0 27 24.0 28 17.0 29 33.0 30 47.0 31 59.0 32 53.0 33 96.0 34 107.0 35 164.0 36 266.0 37 374.0 38 821.0 39 1881.0 40 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.00428265524625 12.955032119914348 6.102783725910064 36.937901498929335 2 21.7 15.049999999999999 36.375 26.875 3 19.1 20.424999999999997 27.400000000000002 33.074999999999996 4 25.674999999999997 28.175 22.075 24.075 5 23.599999999999998 32.275 23.25 20.875 6 21.375 31.175000000000004 23.400000000000002 24.05 7 17.25 20.7 41.025 21.025 8 18.65 19.400000000000002 30.125 31.825 9 18.8 18.75 31.75 30.7 10 21.025 34.949999999999996 23.325000000000003 20.7 11 25.8 22.825 20.075000000000003 31.3 12 22.075 20.724999999999998 26.35 30.85 13 22.400000000000002 24.7 27.55 25.35 14 21.6 24.45 27.875 26.075 15 22.900000000000002 24.85 26.224999999999998 26.025 16 23.925 24.425 25.025 26.625 17 22.825 23.599999999999998 26.35 27.224999999999998 18 22.275 23.400000000000002 26.575 27.750000000000004 19 22.925 24.0 26.6 26.474999999999998 20 22.650000000000002 24.4 26.375 26.575 21 22.225 23.674999999999997 27.450000000000003 26.650000000000002 22 22.925 24.675 25.55 26.85 23 22.55 24.7 25.55 27.200000000000003 24 21.625 23.95 27.175 27.250000000000004 25 23.674999999999997 23.7 24.775 27.85 26 22.775000000000002 23.849999999999998 25.95 27.425 27 21.775 23.75 26.924999999999997 27.55 28 23.025000000000002 24.025 26.150000000000002 26.8 29 22.75 24.125 26.3 26.825 30 22.775000000000002 22.85 25.900000000000002 28.475 31 21.349999999999998 24.224999999999998 24.925 29.5 32 21.025 24.175 26.3 28.499999999999996 33 23.45 23.3 24.375 28.875 34 21.825 24.875 25.85 27.450000000000003 35 22.900000000000002 23.525 25.55 28.025 36 21.85 24.2 25.1 28.849999999999998 37 23.1 24.175 24.875 27.85 38 23.3 23.474999999999998 25.45 27.775 39 23.575 24.3 24.349999999999998 27.775 40 24.85 23.05 24.875 27.224999999999998 41 23.849999999999998 23.599999999999998 24.825 27.725 42 23.380845211302827 23.23080770192548 27.45686421605401 25.93148287071768 43 23.325000000000003 23.549999999999997 25.224999999999998 27.900000000000002 44 23.225 24.2 25.900000000000002 26.674999999999997 45 24.125 23.599999999999998 24.175 28.1 46 23.625 24.075 25.1 27.200000000000003 47 23.674999999999997 22.825 26.424999999999997 27.075 48 23.45 23.425 24.875 28.249999999999996 49 23.325000000000003 23.474999999999998 24.8 28.4 50 23.75 24.45 24.9 26.900000000000002 51 23.25 23.3 25.2 28.249999999999996 52 23.974999999999998 22.7 26.05 27.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 3.5 23 5.0 24 4.0 25 3.0 26 7.0 27 11.0 28 18.0 29 25.0 30 27.5 31 30.0 32 38.0 33 46.0 34 46.5 35 47.0 36 61.5 37 76.0 38 97.5 39 140.0 40 161.0 41 184.0 42 207.0 43 232.5 44 258.0 45 283.0 46 308.0 47 339.5 48 371.0 49 359.5 50 348.0 51 391.5 52 435.0 53 416.0 54 397.0 55 365.5 56 334.0 57 303.0 58 272.0 59 228.5 60 185.0 61 166.0 62 147.0 63 104.5 64 56.0 65 50.0 66 39.0 67 28.0 68 23.5 69 19.0 70 19.5 71 20.0 72 15.5 73 11.0 74 11.0 75 11.0 76 6.5 77 2.0 78 4.0 79 6.0 80 3.0 81 0.0 82 1.0 83 2.0 84 1.5 85 1.0 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.6000000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.025 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.04326035346874 91.025 2 3.0335003956739643 5.75 3 0.5803218148245846 1.6500000000000001 4 0.13189132155104194 0.5 5 0.1582695858612503 0.75 6 0.026378264310208392 0.15 7 0.026378264310208392 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 7 0.17500000000000002 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 6 0.15 No Hit GGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGT 5 0.125 No Hit AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 5 0.125 No Hit CTTCCCTCACGGTACTACTTCGCTATCGGTCACCCAGGAGTATTTAGCCTTG 5 0.125 No Hit GGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAA 5 0.125 No Hit GTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCTCT 5 0.125 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra Read 200000 spots for SRR5423527.sra Written 200000 spots for SRR5423527.sra SRR ids: ['SRR5423527.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_prwjqnof SRR5423527.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423527 file size 704010 SRR5423527 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423527 SRR5423527_1.fastq Input file: SRR5423527_1.fastq trimmed: SRR5423527-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:28:07 2025 >> started Thu Feb 13 12:28:09 2025 >> done (2.038s) 4000000 reads processed; of these: 191 ( 0.00%) short reads filtered out after trimming by size control 170 ( 0.00%) empty reads filtered out after trimming by size control 3999639 (99.99%) reads available; of these: 74110 ( 1.85%) trimmed reads available after processing 3925529 (98.15%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 4 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 5 0.00% 25 9 0.00% 26 12 0.00% 27 16 0.00% 28 21 0.00% 29 29 0.00% 30 29 0.00% 31 49 0.00% 32 65 0.00% 33 56 0.00% 34 47 0.00% 35 56 0.00% 36 75 0.00% 37 97 0.00% 38 98 0.00% 39 108 0.00% 40 171 0.00% 41 198 0.00% 42 231 0.01% 43 292 0.01% 44 373 0.01% 45 679 0.02% 46 1089 0.03% 47 1217 0.03% 48 1763 0.04% 49 3589 0.09% 50 8801 0.22% 51 54921 1.37% 52 3925529 98.15% 3999639 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=34 prefix-density=0.33 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=18.62 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.0 sequence=GCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGT Started job on | Feb 13 12:28:23 Started mapping on | Feb 13 12:28:24 Finished on | Feb 13 12:28:29 Mapping speed, Million of reads per hour | 2879.74 Number of input reads | 3999639 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3236703 Uniquely mapped reads % | 80.92% Average mapped length | 51.84 Number of splices: Total | 401688 Number of splices: Annotated (sjdb) | 397148 Number of splices: GT/AG | 394417 Number of splices: GC/AG | 6716 Number of splices: AT/AC | 168 Number of splices: Non-canonical | 387 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311056 % of reads mapped to multiple loci | 7.78% Number of reads mapped to too many loci | 436873 % of reads mapped to too many loci | 10.92% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.37% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 451880 451880 451880 N_multimapping 311056 311056 311056 N_noFeature 286558 3183292 303831 N_ambiguous 51944 27 15788 UnstrandedReadsAssigned:2898201 PositiveStrandReadsAssigned:53384 NegativeStrandReadsAssigned:2917084 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423527 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423527-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,639 reads, 3,324,399 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR5423527.ke.tsv 34699 SRR5423527.se.tsv 87100 total ==> SRR5423527.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 71 11.1549 Potri.005G024800.1.v4.1 1035 936 3 0.966335 Potri.004G059700.1.v4.1 961 862 4 1.39906 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 36.509 3.87037 Potri.016G087400.1.v4.1 270 171 84 148.104 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 24 8.24136 ==> SRR5423527.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 65 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423527 completed mapping pipeline successfully